ID: 1130455994

View in Genome Browser
Species Human (GRCh38)
Location 15:84108918-84108940
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130455992_1130455994 -7 Left 1130455992 15:84108902-84108924 CCTGATTTGTGAGCATTCTGCTA No data
Right 1130455994 15:84108918-84108940 TCTGCTAGTAAGCCACAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130455994 Original CRISPR TCTGCTAGTAAGCCACAAGG TGG Intergenic
No off target data available for this crispr