ID: 1130457091

View in Genome Browser
Species Human (GRCh38)
Location 15:84121577-84121599
Sequence GCATTTGCTCGGGTGTTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130457083_1130457091 23 Left 1130457083 15:84121531-84121553 CCCCAAACCTGTGCTCCAGGAAG 0: 1
1: 1
2: 2
3: 42
4: 449
Right 1130457091 15:84121577-84121599 GCATTTGCTCGGGTGTTCAGTGG No data
1130457087_1130457091 8 Left 1130457087 15:84121546-84121568 CCAGGAAGAAAACAACCAAGAGT No data
Right 1130457091 15:84121577-84121599 GCATTTGCTCGGGTGTTCAGTGG No data
1130457082_1130457091 24 Left 1130457082 15:84121530-84121552 CCCCCAAACCTGTGCTCCAGGAA 0: 1
1: 1
2: 5
3: 116
4: 1754
Right 1130457091 15:84121577-84121599 GCATTTGCTCGGGTGTTCAGTGG No data
1130457086_1130457091 16 Left 1130457086 15:84121538-84121560 CCTGTGCTCCAGGAAGAAAACAA No data
Right 1130457091 15:84121577-84121599 GCATTTGCTCGGGTGTTCAGTGG No data
1130457088_1130457091 -7 Left 1130457088 15:84121561-84121583 CCAAGAGTCTTCTATTGCATTTG 0: 1
1: 1
2: 0
3: 17
4: 208
Right 1130457091 15:84121577-84121599 GCATTTGCTCGGGTGTTCAGTGG No data
1130457085_1130457091 21 Left 1130457085 15:84121533-84121555 CCAAACCTGTGCTCCAGGAAGAA 0: 1
1: 0
2: 0
3: 20
4: 250
Right 1130457091 15:84121577-84121599 GCATTTGCTCGGGTGTTCAGTGG No data
1130457084_1130457091 22 Left 1130457084 15:84121532-84121554 CCCAAACCTGTGCTCCAGGAAGA No data
Right 1130457091 15:84121577-84121599 GCATTTGCTCGGGTGTTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130457091 Original CRISPR GCATTTGCTCGGGTGTTCAG TGG Intergenic
No off target data available for this crispr