ID: 1130459833

View in Genome Browser
Species Human (GRCh38)
Location 15:84152692-84152714
Sequence GATAAAGCACAGACAGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130459833_1130459837 15 Left 1130459833 15:84152692-84152714 CCTGGCTCTGTCTGTGCTTTATC No data
Right 1130459837 15:84152730-84152752 CCTGCAGCGCCTCAGCATTTGGG No data
1130459833_1130459838 16 Left 1130459833 15:84152692-84152714 CCTGGCTCTGTCTGTGCTTTATC No data
Right 1130459838 15:84152731-84152753 CTGCAGCGCCTCAGCATTTGGGG No data
1130459833_1130459839 22 Left 1130459833 15:84152692-84152714 CCTGGCTCTGTCTGTGCTTTATC No data
Right 1130459839 15:84152737-84152759 CGCCTCAGCATTTGGGGAAGTGG No data
1130459833_1130459842 24 Left 1130459833 15:84152692-84152714 CCTGGCTCTGTCTGTGCTTTATC No data
Right 1130459842 15:84152739-84152761 CCTCAGCATTTGGGGAAGTGGGG No data
1130459833_1130459840 23 Left 1130459833 15:84152692-84152714 CCTGGCTCTGTCTGTGCTTTATC No data
Right 1130459840 15:84152738-84152760 GCCTCAGCATTTGGGGAAGTGGG No data
1130459833_1130459843 29 Left 1130459833 15:84152692-84152714 CCTGGCTCTGTCTGTGCTTTATC No data
Right 1130459843 15:84152744-84152766 GCATTTGGGGAAGTGGGGAAAGG No data
1130459833_1130459834 -10 Left 1130459833 15:84152692-84152714 CCTGGCTCTGTCTGTGCTTTATC No data
Right 1130459834 15:84152705-84152727 GTGCTTTATCTTCATGCTCATGG No data
1130459833_1130459835 14 Left 1130459833 15:84152692-84152714 CCTGGCTCTGTCTGTGCTTTATC No data
Right 1130459835 15:84152729-84152751 TCCTGCAGCGCCTCAGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130459833 Original CRISPR GATAAAGCACAGACAGAGCC AGG (reversed) Intergenic
No off target data available for this crispr