ID: 1130459834

View in Genome Browser
Species Human (GRCh38)
Location 15:84152705-84152727
Sequence GTGCTTTATCTTCATGCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130459826_1130459834 20 Left 1130459826 15:84152662-84152684 CCTGGGTCCTGGTGGGACCAGGC No data
Right 1130459834 15:84152705-84152727 GTGCTTTATCTTCATGCTCATGG No data
1130459831_1130459834 -8 Left 1130459831 15:84152690-84152712 CCCCTGGCTCTGTCTGTGCTTTA No data
Right 1130459834 15:84152705-84152727 GTGCTTTATCTTCATGCTCATGG No data
1130459830_1130459834 3 Left 1130459830 15:84152679-84152701 CCAGGCACTGGCCCCTGGCTCTG No data
Right 1130459834 15:84152705-84152727 GTGCTTTATCTTCATGCTCATGG No data
1130459833_1130459834 -10 Left 1130459833 15:84152692-84152714 CCTGGCTCTGTCTGTGCTTTATC No data
Right 1130459834 15:84152705-84152727 GTGCTTTATCTTCATGCTCATGG No data
1130459828_1130459834 13 Left 1130459828 15:84152669-84152691 CCTGGTGGGACCAGGCACTGGCC No data
Right 1130459834 15:84152705-84152727 GTGCTTTATCTTCATGCTCATGG No data
1130459832_1130459834 -9 Left 1130459832 15:84152691-84152713 CCCTGGCTCTGTCTGTGCTTTAT No data
Right 1130459834 15:84152705-84152727 GTGCTTTATCTTCATGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130459834 Original CRISPR GTGCTTTATCTTCATGCTCA TGG Intergenic
No off target data available for this crispr