ID: 1130459838

View in Genome Browser
Species Human (GRCh38)
Location 15:84152731-84152753
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130459830_1130459838 29 Left 1130459830 15:84152679-84152701 CCAGGCACTGGCCCCTGGCTCTG No data
Right 1130459838 15:84152731-84152753 CTGCAGCGCCTCAGCATTTGGGG No data
1130459832_1130459838 17 Left 1130459832 15:84152691-84152713 CCCTGGCTCTGTCTGTGCTTTAT No data
Right 1130459838 15:84152731-84152753 CTGCAGCGCCTCAGCATTTGGGG No data
1130459833_1130459838 16 Left 1130459833 15:84152692-84152714 CCTGGCTCTGTCTGTGCTTTATC No data
Right 1130459838 15:84152731-84152753 CTGCAGCGCCTCAGCATTTGGGG No data
1130459831_1130459838 18 Left 1130459831 15:84152690-84152712 CCCCTGGCTCTGTCTGTGCTTTA No data
Right 1130459838 15:84152731-84152753 CTGCAGCGCCTCAGCATTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130459838 Original CRISPR CTGCAGCGCCTCAGCATTTG GGG Intergenic
No off target data available for this crispr