ID: 1130459843

View in Genome Browser
Species Human (GRCh38)
Location 15:84152744-84152766
Sequence GCATTTGGGGAAGTGGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130459832_1130459843 30 Left 1130459832 15:84152691-84152713 CCCTGGCTCTGTCTGTGCTTTAT No data
Right 1130459843 15:84152744-84152766 GCATTTGGGGAAGTGGGGAAAGG No data
1130459836_1130459843 -9 Left 1130459836 15:84152730-84152752 CCTGCAGCGCCTCAGCATTTGGG No data
Right 1130459843 15:84152744-84152766 GCATTTGGGGAAGTGGGGAAAGG No data
1130459833_1130459843 29 Left 1130459833 15:84152692-84152714 CCTGGCTCTGTCTGTGCTTTATC No data
Right 1130459843 15:84152744-84152766 GCATTTGGGGAAGTGGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130459843 Original CRISPR GCATTTGGGGAAGTGGGGAA AGG Intergenic
No off target data available for this crispr