ID: 1130460085

View in Genome Browser
Species Human (GRCh38)
Location 15:84154071-84154093
Sequence GAGCTGTCCTGGTGCCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130460085_1130460099 26 Left 1130460085 15:84154071-84154093 CCTGCTGGGCACCAGGACAGCTC No data
Right 1130460099 15:84154120-84154142 TTGAGACAGAGTCAGGGAGATGG No data
1130460085_1130460096 19 Left 1130460085 15:84154071-84154093 CCTGCTGGGCACCAGGACAGCTC No data
Right 1130460096 15:84154113-84154135 CTCAGCCTTGAGACAGAGTCAGG No data
1130460085_1130460097 20 Left 1130460085 15:84154071-84154093 CCTGCTGGGCACCAGGACAGCTC No data
Right 1130460097 15:84154114-84154136 TCAGCCTTGAGACAGAGTCAGGG No data
1130460085_1130460100 29 Left 1130460085 15:84154071-84154093 CCTGCTGGGCACCAGGACAGCTC No data
Right 1130460100 15:84154123-84154145 AGACAGAGTCAGGGAGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130460085 Original CRISPR GAGCTGTCCTGGTGCCCAGC AGG (reversed) Intergenic
No off target data available for this crispr