ID: 1130460183

View in Genome Browser
Species Human (GRCh38)
Location 15:84154495-84154517
Sequence CCTCTCTGAGCCTCGGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130460169_1130460183 22 Left 1130460169 15:84154450-84154472 CCCTGGCCTAGAGAGGATGCTGT No data
Right 1130460183 15:84154495-84154517 CCTCTCTGAGCCTCGGCTGCTGG No data
1130460171_1130460183 16 Left 1130460171 15:84154456-84154478 CCTAGAGAGGATGCTGTGTGACC No data
Right 1130460183 15:84154495-84154517 CCTCTCTGAGCCTCGGCTGCTGG No data
1130460174_1130460183 -6 Left 1130460174 15:84154478-84154500 CCCGCCCAGGCACCCCACCTCTC No data
Right 1130460183 15:84154495-84154517 CCTCTCTGAGCCTCGGCTGCTGG No data
1130460173_1130460183 -5 Left 1130460173 15:84154477-84154499 CCCCGCCCAGGCACCCCACCTCT No data
Right 1130460183 15:84154495-84154517 CCTCTCTGAGCCTCGGCTGCTGG No data
1130460176_1130460183 -10 Left 1130460176 15:84154482-84154504 CCCAGGCACCCCACCTCTCTGAG No data
Right 1130460183 15:84154495-84154517 CCTCTCTGAGCCTCGGCTGCTGG No data
1130460170_1130460183 21 Left 1130460170 15:84154451-84154473 CCTGGCCTAGAGAGGATGCTGTG No data
Right 1130460183 15:84154495-84154517 CCTCTCTGAGCCTCGGCTGCTGG No data
1130460175_1130460183 -7 Left 1130460175 15:84154479-84154501 CCGCCCAGGCACCCCACCTCTCT No data
Right 1130460183 15:84154495-84154517 CCTCTCTGAGCCTCGGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130460183 Original CRISPR CCTCTCTGAGCCTCGGCTGC TGG Intergenic
No off target data available for this crispr