ID: 1130462990

View in Genome Browser
Species Human (GRCh38)
Location 15:84172591-84172613
Sequence CAGGGGGCGCGCGGGTTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 4, 1: 2, 2: 0, 3: 12, 4: 137}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130462985_1130462990 -9 Left 1130462985 15:84172577-84172599 CCGAAACGGGTGCGCAGGGGGCG 0: 6
1: 0
2: 1
3: 1
4: 27
Right 1130462990 15:84172591-84172613 CAGGGGGCGCGCGGGTTGAGGGG 0: 4
1: 2
2: 0
3: 12
4: 137
1130462982_1130462990 -6 Left 1130462982 15:84172574-84172596 CCGCCGAAACGGGTGCGCAGGGG 0: 6
1: 0
2: 1
3: 1
4: 32
Right 1130462990 15:84172591-84172613 CAGGGGGCGCGCGGGTTGAGGGG 0: 4
1: 2
2: 0
3: 12
4: 137
1130462979_1130462990 1 Left 1130462979 15:84172567-84172589 CCTGCAGCCGCCGAAACGGGTGC 0: 6
1: 0
2: 0
3: 5
4: 55
Right 1130462990 15:84172591-84172613 CAGGGGGCGCGCGGGTTGAGGGG 0: 4
1: 2
2: 0
3: 12
4: 137
1130462975_1130462990 27 Left 1130462975 15:84172541-84172563 CCGGAAGCGCGCGCATGCTCTGG 0: 4
1: 3
2: 3
3: 2
4: 45
Right 1130462990 15:84172591-84172613 CAGGGGGCGCGCGGGTTGAGGGG 0: 4
1: 2
2: 0
3: 12
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130462990 Original CRISPR CAGGGGGCGCGCGGGTTGAG GGG Intronic