ID: 1130466409

View in Genome Browser
Species Human (GRCh38)
Location 15:84194795-84194817
Sequence ACCCAAAGGCAGAACATGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130466400_1130466409 22 Left 1130466400 15:84194750-84194772 CCACCAATGGAAGCTGAGGCCCT No data
Right 1130466409 15:84194795-84194817 ACCCAAAGGCAGAACATGAAGGG No data
1130466401_1130466409 19 Left 1130466401 15:84194753-84194775 CCAATGGAAGCTGAGGCCCTAAA No data
Right 1130466409 15:84194795-84194817 ACCCAAAGGCAGAACATGAAGGG No data
1130466398_1130466409 29 Left 1130466398 15:84194743-84194765 CCATTTTCCACCAATGGAAGCTG No data
Right 1130466409 15:84194795-84194817 ACCCAAAGGCAGAACATGAAGGG No data
1130466405_1130466409 2 Left 1130466405 15:84194770-84194792 CCTAAAAGGGTCAGTCTCTTCCT No data
Right 1130466409 15:84194795-84194817 ACCCAAAGGCAGAACATGAAGGG No data
1130466404_1130466409 3 Left 1130466404 15:84194769-84194791 CCCTAAAAGGGTCAGTCTCTTCC No data
Right 1130466409 15:84194795-84194817 ACCCAAAGGCAGAACATGAAGGG No data
1130466397_1130466409 30 Left 1130466397 15:84194742-84194764 CCCATTTTCCACCAATGGAAGCT No data
Right 1130466409 15:84194795-84194817 ACCCAAAGGCAGAACATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130466409 Original CRISPR ACCCAAAGGCAGAACATGAA GGG Intergenic
No off target data available for this crispr