ID: 1130472289

View in Genome Browser
Species Human (GRCh38)
Location 15:84236102-84236124
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 9, 1: 1, 2: 23, 3: 28, 4: 222}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130472281_1130472289 4 Left 1130472281 15:84236075-84236097 CCACCCCTTCAGCAAGCAGCCCA 0: 25
1: 7
2: 4
3: 36
4: 273
Right 1130472289 15:84236102-84236124 CTGCCCTTGCCAATCACCCCAGG 0: 9
1: 1
2: 23
3: 28
4: 222
1130472278_1130472289 19 Left 1130472278 15:84236060-84236082 CCTAGTCAGTCAGCCCCACCCCT 0: 8
1: 0
2: 0
3: 22
4: 273
Right 1130472289 15:84236102-84236124 CTGCCCTTGCCAATCACCCCAGG 0: 9
1: 1
2: 23
3: 28
4: 222
1130472283_1130472289 0 Left 1130472283 15:84236079-84236101 CCCTTCAGCAAGCAGCCCAGTCC 0: 16
1: 10
2: 12
3: 24
4: 182
Right 1130472289 15:84236102-84236124 CTGCCCTTGCCAATCACCCCAGG 0: 9
1: 1
2: 23
3: 28
4: 222
1130472284_1130472289 -1 Left 1130472284 15:84236080-84236102 CCTTCAGCAAGCAGCCCAGTCCC 0: 11
1: 12
2: 14
3: 24
4: 270
Right 1130472289 15:84236102-84236124 CTGCCCTTGCCAATCACCCCAGG 0: 9
1: 1
2: 23
3: 28
4: 222
1130472280_1130472289 5 Left 1130472280 15:84236074-84236096 CCCACCCCTTCAGCAAGCAGCCC 0: 21
1: 10
2: 6
3: 38
4: 321
Right 1130472289 15:84236102-84236124 CTGCCCTTGCCAATCACCCCAGG 0: 9
1: 1
2: 23
3: 28
4: 222
1130472279_1130472289 6 Left 1130472279 15:84236073-84236095 CCCCACCCCTTCAGCAAGCAGCC 0: 21
1: 10
2: 5
3: 31
4: 333
Right 1130472289 15:84236102-84236124 CTGCCCTTGCCAATCACCCCAGG 0: 9
1: 1
2: 23
3: 28
4: 222
1130472275_1130472289 30 Left 1130472275 15:84236049-84236071 CCCAACCAAAGCCTAGTCAGTCA 0: 8
1: 0
2: 2
3: 10
4: 154
Right 1130472289 15:84236102-84236124 CTGCCCTTGCCAATCACCCCAGG 0: 9
1: 1
2: 23
3: 28
4: 222
1130472282_1130472289 1 Left 1130472282 15:84236078-84236100 CCCCTTCAGCAAGCAGCCCAGTC 0: 22
1: 8
2: 6
3: 20
4: 185
Right 1130472289 15:84236102-84236124 CTGCCCTTGCCAATCACCCCAGG 0: 9
1: 1
2: 23
3: 28
4: 222
1130472276_1130472289 29 Left 1130472276 15:84236050-84236072 CCAACCAAAGCCTAGTCAGTCAG 0: 8
1: 0
2: 7
3: 32
4: 97
Right 1130472289 15:84236102-84236124 CTGCCCTTGCCAATCACCCCAGG 0: 9
1: 1
2: 23
3: 28
4: 222
1130472277_1130472289 25 Left 1130472277 15:84236054-84236076 CCAAAGCCTAGTCAGTCAGCCCC 0: 8
1: 0
2: 7
3: 30
4: 101
Right 1130472289 15:84236102-84236124 CTGCCCTTGCCAATCACCCCAGG 0: 9
1: 1
2: 23
3: 28
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900269552 1:1780020-1780042 CTTCCCTTTCCAGTCACCCTTGG - Exonic
901126698 1:6934449-6934471 CTGCCCTTACCCATCCTCCCAGG - Intronic
901953966 1:12770746-12770768 CTTCCCTTTCCAAGCTCCCCTGG - Intergenic
902714456 1:18262877-18262899 TTGCAGTTGCCAACCACCCCTGG - Intronic
905340678 1:37275310-37275332 CTGCCACTGCCAAAGACCCCCGG + Intergenic
908930946 1:69315490-69315512 CCTGCCTTGTCAATCACCCCAGG - Intergenic
909461170 1:75916243-75916265 CATCCCTTGCCAATCCCCCAAGG - Intergenic
909904050 1:81174810-81174832 CTGCCCTGCCCCATCATCCCAGG - Intergenic
912378791 1:109235204-109235226 CTGCCTTTGCCAATCACCTGTGG - Exonic
917958670 1:180125620-180125642 CTCCCCTTGCCTATCCCCCGAGG + Intergenic
923043018 1:230333233-230333255 CTCCCCGTGACAATCTCCCCAGG + Intronic
923800613 1:237205283-237205305 CTCCCCTTGCCAGTCACCTGTGG - Intronic
1064332683 10:14408543-14408565 CTGCCATTGCCATTTATCCCAGG + Intronic
1065219314 10:23480070-23480092 CTGCCCTCTACTATCACCCCTGG + Intergenic
1065918904 10:30374096-30374118 CTGCCCTCAGCAGTCACCCCTGG - Intronic
1068072081 10:52207698-52207720 CTGCTCTTGCCATAGACCCCTGG - Intronic
1069513370 10:69058269-69058291 CTGCCCATACCAGGCACCCCAGG - Intergenic
1069981350 10:72255089-72255111 ATGCCCTGGCCTCTCACCCCAGG + Intergenic
1070430511 10:76333312-76333334 CTCTCCTTTCCAATTACCCCTGG - Intronic
1071980829 10:91003156-91003178 CTGCCTCAGCCAAACACCCCAGG + Intergenic
1076148032 10:128140715-128140737 CTGTCCTTGCAAATCTCTCCTGG + Intergenic
1076226315 10:128779120-128779142 CTGCCTTTCCCACCCACCCCCGG + Intergenic
1079314610 11:19397095-19397117 CCGGCCATGCCAACCACCCCTGG - Intronic
1080936627 11:36870500-36870522 CTGCCTTTTCCACTCATCCCCGG + Intergenic
1083275446 11:61594564-61594586 CTGCCCTCACCCACCACCCCAGG - Intergenic
1083681492 11:64353866-64353888 CTGCCCTGGCCTCTGACCCCAGG + Intronic
1083793629 11:65001941-65001963 CTGCCCTTGCCAATCTCACCTGG - Intergenic
1083794589 11:65007856-65007878 CTGGCCTTGCCAATCTCACCTGG + Intergenic
1088596715 11:111446518-111446540 CTGTCCCTGCCAATCACCTGAGG - Intronic
1090749755 11:129735124-129735146 CTGTCCTTCCCAGCCACCCCTGG + Intergenic
1091236398 11:134025122-134025144 CTGCCCCTGCCAATGAAGCCGGG + Intergenic
1092171170 12:6374905-6374927 GTGCCCTCTCCCATCACCCCTGG + Exonic
1097820852 12:64127980-64128002 CAAGCCTTGCCAGTCACCCCCGG + Exonic
1102012222 12:109625777-109625799 CTGCCCTTGCCAAGTACACCAGG + Intergenic
1102836765 12:116070139-116070161 CTGCCCTTGGACATGACCCCTGG - Intronic
1103248981 12:119483565-119483587 TTGCCCTTGGCAATCAGCACGGG + Intronic
1104897041 12:132169466-132169488 CTGCCCGTGGCAGGCACCCCAGG + Intergenic
1105713273 13:23033918-23033940 CTGCCCTTGGCAGTGACTCCAGG - Intergenic
1106186232 13:27412415-27412437 CTGCCCTTACCAGTTTCCCCTGG - Intergenic
1108576963 13:51799136-51799158 CTCCCCTTGTCTCTCACCCCAGG + Intronic
1109996546 13:70134741-70134763 CTGCCCTTGGAAATCAACACAGG + Intergenic
1113047697 13:106173571-106173593 CTGCCCTGGCCCATGTCCCCTGG - Intergenic
1117465083 14:55984928-55984950 GTGCCCCTGCCCAGCACCCCTGG - Intergenic
1121638798 14:95471727-95471749 CAGACCTTGCCAAGCACTCCTGG - Intronic
1122641362 14:103161482-103161504 CTGGCCTAGCAAATCTCCCCAGG - Intergenic
1122688146 14:103519618-103519640 CTGCCCTTCCCCCTCCCCCCTGG + Intergenic
1123449069 15:20349212-20349234 GTGCCCTTGCCTGTCACCACAGG + Intergenic
1123472046 15:20562705-20562727 CTGCCCTCACCAATCACCCCAGG + Intergenic
1123645957 15:22437648-22437670 CTGCCCTCACCAATCACCCCAGG - Intergenic
1123667226 15:22617361-22617383 CCACCCTCGCCAATCATCCCTGG - Intergenic
1123667266 15:22617502-22617524 TTGCCCTCGCCAATCACCCCAGG - Intergenic
1123682924 15:22775624-22775646 CTGCCCTCACCAGTCACCCCAGG - Intronic
1123682961 15:22775773-22775795 CTGCCCTCACCGGTCACCCCAGG - Intronic
1123732350 15:23157696-23157718 CTGCCCTCACCAATCACCCCAGG + Intergenic
1123750485 15:23355078-23355100 CTGCCCTCACCAATCACCCCAGG + Intronic
1123762946 15:23446746-23446768 CTGCCCTCACCAGTCGCCCCAGG - Intronic
1123762986 15:23446893-23446915 CGGCCCTTGCCAGTGACCCCAGG - Intronic
1124282854 15:28378994-28379016 CTGCCCTCACCAATCACCCCAGG + Intronic
1124299845 15:28532619-28532641 CTGCCCTCACCAATCACCCCAGG - Intronic
1124321067 15:28711928-28711950 CCACCCTCGCCAATCATCCCTGG - Intronic
1124321107 15:28712069-28712091 TTGCCCTCGCCAATCACCCCAGG - Intronic
1124334670 15:28848147-28848169 CTGCCCTCACCAGTCACCCCAGG - Intergenic
1124334708 15:28848296-28848318 CTGCCCTCACCGGTCACCCCAGG - Intergenic
1124481391 15:30083286-30083308 TTGCCCTCGCCAATCACCCCAGG + Intronic
1124487846 15:30135382-30135404 TTGCCCTCGCCAATCACCCCAGG + Intronic
1124522203 15:30413908-30413930 TTGCCCTCGCCAATCACCCCAGG - Intronic
1124536462 15:30552310-30552332 TTGCCCTCGCCAATCACCCCAGG + Intronic
1124542935 15:30604359-30604381 TTGCCCTCGCCAATCACCCCAGG + Intronic
1124562936 15:30791943-30791965 CCGCCCTCGCCAGTCATCCCTGG + Intergenic
1124755683 15:32402939-32402961 TTGCCCTCGCCAATCACCCCAGG - Intronic
1124762189 15:32455282-32455304 TTGCCCTCGCCAATCACCCCAGG - Intronic
1124776440 15:32593786-32593808 TTGCCCTCGCCAATCACCCCAGG + Intronic
1124960419 15:34389436-34389458 CTGCCCTCGCCGATCACCCCGGG - Intronic
1124977048 15:34535657-34535679 CTGCCCTCGCCGATCACCCCGGG - Intronic
1127587135 15:60389095-60389117 CTGGCCTTAACTATCACCCCTGG + Intronic
1129029062 15:72605441-72605463 CTGCCCTCAACAGTCACCCCAGG + Intergenic
1129263294 15:74380952-74380974 CTGCCCCTGCCCCTCACCCCAGG + Intergenic
1129474505 15:75775862-75775884 CTGCCCTCACCAACCACCCCAGG + Intergenic
1129616415 15:77101822-77101844 CAGCCCTTGCCCAACACCCCAGG + Exonic
1129838269 15:78727447-78727469 CTGCCCTCACCAATCACCCCAGG + Intronic
1130260263 15:82348931-82348953 CTGCCCTCACCAGTCATCCCTGG - Intronic
1130260314 15:82349086-82349108 CTGCCCTTGCCAATCACCCCAGG - Intronic
1130268416 15:82430347-82430369 CTGCCCTTGCCAATCACCCCAGG + Intronic
1130268467 15:82430502-82430524 CTGCCCTCACCAGTCATCCCTGG + Intronic
1130280919 15:82519921-82519943 CTGCCCTTGCCAATCACCCCAGG + Intergenic
1130280970 15:82520076-82520098 CTGCCCTCACCAGTCATCCCTGG + Intergenic
1130472289 15:84236102-84236124 CTGCCCTTGCCAATCACCCCAGG + Intronic
1130472340 15:84236257-84236279 CTGCCCTCACCAGTCATCCCTGG + Intronic
1130479782 15:84350673-84350695 CTGCCCTTGCCAATCACCCCAGG + Intergenic
1130479831 15:84350828-84350850 CTGCCCTCACCAGTCATCCCTGG + Intergenic
1130483914 15:84387106-84387128 CTGCCCTTGCCAATCACCCCAGG + Intergenic
1130491939 15:84437301-84437323 CTGCCCTCACCAGTCATCCCTGG - Intergenic
1130491988 15:84437456-84437478 CTGCCCTTGCCAATCACCCCAGG - Intergenic
1130503553 15:84516341-84516363 CTGCCCTCACCAGTCATCCCTGG - Intergenic
1130503604 15:84516496-84516518 CTGCCCTTGCCAATCACCCCAGG - Intergenic
1130594587 15:85240738-85240760 CTGCCCTTGCCAATCACCCCAGG + Intergenic
1130594638 15:85240893-85240915 CTGCCCTCACCAGTCATCCCTGG + Intergenic
1132082994 15:98883556-98883578 CTCCCCATCCCTATCACCCCAGG - Intronic
1132433958 15:101781734-101781756 CTGCCCTCACCAATTGCCCCAGG - Intergenic
1133223107 16:4327701-4327723 CTGCCCTTCCCACCCACCGCAGG - Intronic
1134063725 16:11213627-11213649 CTGCACTTGCCCATCAGGCCAGG + Intergenic
1135550894 16:23397481-23397503 CTGCCCTCCCCATTCACCCCTGG - Intronic
1135590177 16:23699418-23699440 ATGCCTTTACCAATCAGCCCAGG - Intronic
1136103751 16:28013983-28014005 CTGCCCCTGCCAGTCATTCCAGG - Intronic
1136245125 16:28970894-28970916 CTTCTCTTGCCCATGACCCCAGG + Intergenic
1136628251 16:31474629-31474651 CTGCCCTTGCCAGTCGGCTCTGG - Exonic
1137578969 16:49621890-49621912 CTGCCCTGTTCACTCACCCCAGG + Intronic
1137683972 16:50373184-50373206 CTGTCATAGCGAATCACCCCAGG - Intergenic
1138511198 16:57509430-57509452 CTGTTCTTGGCAGTCACCCCTGG + Intergenic
1142129509 16:88426280-88426302 TTGTCCTTGCCACTGACCCCTGG - Intergenic
1142151423 16:88514257-88514279 CGGCCCCTGCCATTCACCCCAGG + Intronic
1143852348 17:9822261-9822283 CTGGCCCTGCCATTCTCCCCAGG + Intronic
1143968324 17:10773380-10773402 CTGCCTTTGAAACTCACCCCTGG + Intergenic
1143972235 17:10803999-10804021 CCTCCCATGCAAATCACCCCCGG - Intergenic
1146530764 17:33605937-33605959 GTGCCTGTGCCACTCACCCCAGG - Intronic
1147048841 17:37775578-37775600 CTGCCTGTTCCATTCACCCCTGG - Intergenic
1147160992 17:38569353-38569375 CTGCTCGTGCCAGGCACCCCCGG - Intronic
1148835926 17:50465739-50465761 TCGCCCTTACCAATAACCCCTGG - Exonic
1151262666 17:72929012-72929034 CTGCCCCTGGCCATCACCCCTGG - Intronic
1151357916 17:73571412-73571434 CTGCCCTTTCCAATGCCCACAGG + Intronic
1151541715 17:74768013-74768035 ATGCCCTGGCCACCCACCCCTGG - Intronic
1152339575 17:79716652-79716674 GTGCCCTTGCCTGTCACCACAGG - Intergenic
1152732820 17:81981195-81981217 CAGCCCTTTCCAAAGACCCCTGG - Intronic
1155017279 18:21856558-21856580 CTCCCCCTGCCCAACACCCCCGG - Intronic
1156498149 18:37539414-37539436 CAGCCCTTGTCCACCACCCCAGG - Intronic
1156655851 18:39285155-39285177 CTACCATTGCCAATCATTCCTGG + Intergenic
1157191023 18:45581579-45581601 CTGCCTCTGCCACTCACCCAAGG + Intronic
1157328480 18:46686133-46686155 CTGCCCTTGCCACTACCCCATGG - Intronic
1159938341 18:74386397-74386419 CTGCCCTCTGCAATCACCCAGGG - Intergenic
1160347055 18:78140503-78140525 CGCCCCTTGCCAAGCACCACAGG - Intergenic
1160408532 18:78659474-78659496 CTGCATTTTCCAAACACCCCTGG - Intergenic
1161026082 19:2038038-2038060 CTGCCCCTTCCAAAGACCCCTGG - Exonic
1161490119 19:4556905-4556927 CGGCCCCTGCGAATCAGCCCTGG - Intronic
1161913541 19:7212356-7212378 CTGCCATTCCCCATCATCCCCGG + Intronic
1161990103 19:7679894-7679916 CTGCACGTGACAATGACCCCGGG + Intronic
1162940547 19:14006361-14006383 CGGCCGCCGCCAATCACCCCGGG - Intronic
1163640807 19:18461016-18461038 CTGCTCTTGAGAAACACCCCGGG - Intronic
1165939082 19:39406509-39406531 CTGCTCTTGTCAATTGCCCCTGG + Intergenic
1166743641 19:45129659-45129681 GTGCCCTCCCCACTCACCCCTGG + Intronic
1167079645 19:47270518-47270540 CTTCCCTTCCCAATGACACCTGG + Intronic
1168113003 19:54205246-54205268 CTGCCCTTGCCCACAGCCCCAGG - Intronic
924960030 2:26430-26452 CTGCCTTCCCTAATCACCCCAGG - Intergenic
925360617 2:3278039-3278061 CTGCCCTTCCTAATCATCCCTGG + Intronic
926592228 2:14751827-14751849 CTGGCCTTTCCAAGCACCACAGG + Intergenic
929368806 2:41195892-41195914 ATGCTTTTGCAAATCACCCCAGG - Intergenic
931516747 2:63054578-63054600 CTGCCCTTGTCTTCCACCCCGGG + Intronic
932430943 2:71673171-71673193 CTGTCCTTGCCACTCACCCAGGG + Intronic
932589903 2:73059045-73059067 CTGCCCTTGGGGATCCCCCCTGG - Intronic
934138439 2:89020246-89020268 CTCTCCCTGCCCATCACCCCTGG - Intergenic
934155523 2:89196332-89196354 CTCTCCTTGTCTATCACCCCTGG - Intergenic
934211800 2:89986427-89986449 CTCTCCTTGTCTATCACCCCTGG + Intergenic
934224737 2:90122275-90122297 CTCTCCCTGCCCATCACCCCTGG + Intergenic
934230816 2:90180379-90180401 CTCTCCCTGCCCATCACCCCTGG + Intergenic
934789480 2:97046612-97046634 CTGTCCCTGTCCATCACCCCCGG + Intergenic
936906120 2:117537130-117537152 GTGCCCTGGCTACTCACCCCTGG + Intergenic
937927696 2:127179875-127179897 TTGCTCTTGCCAGACACCCCAGG - Intergenic
938071236 2:128309516-128309538 CTGCCCCTGCCCATGACCACCGG + Intronic
938822724 2:134975575-134975597 CTCCCCTTGCCCACCACCACCGG - Intronic
941494499 2:166183000-166183022 CTGCTCATTACAATCACCCCTGG + Intergenic
941973900 2:171382552-171382574 CTCCCCTTGCCCTCCACCCCTGG - Intronic
946366009 2:219249502-219249524 CTGCCCTTGCCTTTCCTCCCTGG - Exonic
947637284 2:231686453-231686475 CTGGCCTTGCTCCTCACCCCTGG + Intergenic
948283616 2:236767931-236767953 CTGCACTGGCCATTAACCCCAGG + Intergenic
948286600 2:236790736-236790758 CTGCCCTTGCCAAGTCCTCCAGG - Intergenic
948312571 2:236999720-236999742 CAGCCATTGCCAATGTCCCCTGG - Intergenic
948347214 2:237308556-237308578 CTGTACTTGCCGAGCACCCCAGG + Intergenic
948540612 2:238689336-238689358 CTGCCCTTGCCATGATCCCCAGG + Intergenic
948859279 2:240745106-240745128 CTGCCCTGGCTGAGCACCCCCGG + Intronic
1169277994 20:4246418-4246440 CTGTCCTTCCCAATCTCTCCTGG - Intronic
1170095485 20:12641583-12641605 GTGCCCATGCCAACCCCCCCTGG + Intergenic
1170857568 20:20071168-20071190 CTGCCCTTTCCTATCCCCCCTGG - Intronic
1171088485 20:22261911-22261933 TTGCTCTTCCCACTCACCCCAGG + Intergenic
1171173936 20:23037175-23037197 CTTCCCTCCCCACTCACCCCCGG + Intergenic
1173818559 20:46006173-46006195 CTGCCCCTCCCACTCACCCAGGG + Intergenic
1173979515 20:47212344-47212366 CTGCCATAGCCAATCACCACAGG + Intronic
1173988732 20:47283333-47283355 CTGCCCAGGCTAATCAACCCAGG + Intronic
1175924056 20:62463331-62463353 CTCCCCCTGCCCATCACCCGTGG - Intergenic
1175924097 20:62463431-62463453 CTCCCCCTGCCCATCACCCGGGG - Intergenic
1175993646 20:62802409-62802431 TTGCCTTTCCCAGTCACCCCTGG - Intergenic
1178707320 21:34886772-34886794 CTGCCCTCGCGGATCTCCCCCGG + Intronic
1178877342 21:36423131-36423153 CTTCACTTCCCAACCACCCCAGG - Intergenic
1179944857 21:44666256-44666278 CTGACCTTGCCCATCCCCCCAGG - Exonic
1179946500 21:44681644-44681666 CTGAACTTGCCTATCCCCCCAGG - Exonic
1180152762 21:45960173-45960195 CTGCCCTTGCCAAGCATCCCAGG + Intergenic
1180583127 22:16860224-16860246 CTGCCCTTTCCTCTCCCCCCAGG - Intergenic
1181355001 22:22292204-22292226 CTGGCCCTGCCAATGACCCTGGG - Intergenic
1182000188 22:26913754-26913776 ATGCCCTTCCCCATCCCCCCAGG + Intergenic
1183303628 22:37070579-37070601 CTGCCATGGCCACTCACCCTCGG + Exonic
1183521665 22:38299227-38299249 CTGCCCTCGCCAAGCACCCTGGG + Intronic
1184438778 22:44496445-44496467 CTGCCCTCTCCAAGCTCCCCTGG - Exonic
1184690017 22:46113299-46113321 TTGGCGTTGCCCATCACCCCAGG + Intronic
1184849877 22:47113957-47113979 CTGCCCCTGCCAGTGGCCCCTGG - Intronic
1185416284 22:50712207-50712229 CTCCCCTGGCCAAAGACCCCAGG + Intergenic
949518774 3:4830764-4830786 CTGCCCTTGAGAATCCCCTCTGG - Intronic
952183291 3:30941944-30941966 CTGTACTTCCCATTCACCCCCGG + Intergenic
953807226 3:46081036-46081058 CTGCCCGTGCCAATGAGCCATGG + Intergenic
954622773 3:52005358-52005380 CTGCCCTCCCCAATCTCCCCTGG + Intergenic
954644033 3:52119867-52119889 CTGGCCTTCCCAATAACCCAGGG - Intronic
954803655 3:53202475-53202497 CTGCCTTTGCCCAGCTCCCCGGG - Intergenic
955404981 3:58620317-58620339 CTGACCTTCCCAGCCACCCCTGG + Intronic
959952443 3:112194362-112194384 CTGGGCTTTCCAATCACCACAGG + Intronic
961094389 3:124142098-124142120 CAGCCCTTCCCAAGTACCCCAGG + Intronic
964917706 3:161856087-161856109 CTGCCCTTTCCCCTAACCCCTGG - Intergenic
967055521 3:185825696-185825718 CTGCCCTCGCCTCTCACCTCCGG - Intergenic
968621049 4:1603628-1603650 CTGCCCCTCCCAAGCATCCCTGG + Intergenic
968957877 4:3728323-3728345 CTCCCCCTGCCAGTCACCCCCGG + Intergenic
969155983 4:5210323-5210345 CTGCCCTTCCCCATCTCCTCGGG + Intronic
969297892 4:6280305-6280327 CGGCCCCTGCCCATCAGCCCTGG - Intronic
970354636 4:15239639-15239661 CTGCCCTTGCCATTCAATCTGGG - Intergenic
970616342 4:17771730-17771752 CTGCCCTGGCCTCTCAGCCCAGG + Intronic
971265970 4:25096412-25096434 CTGCCCTGGCCAACTCCCCCAGG + Intergenic
975449827 4:74511318-74511340 CTCCCCTAGCCCCTCACCCCCGG - Intergenic
986393524 5:7306158-7306180 CTGCCCTCACCAGTCACCCCAGG - Intergenic
986393561 5:7306307-7306329 CTGCCCTCACCGGTCACCCCAGG - Intergenic
987299114 5:16581114-16581136 CTGCCCTGGGCAATCACACAGGG + Intronic
987346431 5:16983160-16983182 CTGGCCTTGCAAACCACCCAAGG - Intergenic
987576373 5:19733699-19733721 CTGCTCTTGCCCATGACTCCAGG - Intronic
988186910 5:27876504-27876526 CTATCCTTCCCTATCACCCCTGG + Intergenic
988648399 5:33122112-33122134 TTGCCCTTGCCTATCACTCTTGG + Intergenic
991288313 5:65005422-65005444 CTGCCATTGCCAATGCCCACAGG - Intronic
995524578 5:113040249-113040271 CAGCCCTTGTCACTCAGCCCTGG - Intronic
997000392 5:129752570-129752592 CTCCCCTTGCCATTAAACCCCGG - Intronic
997378866 5:133421098-133421120 CTGCCATTGCCCTCCACCCCTGG + Intronic
999698707 5:154208367-154208389 CTGCCCCTCCCACTCACCTCAGG + Intronic
1001755472 5:174165263-174165285 CTGCCCCTCCCCAGCACCCCAGG + Intronic
1001784184 5:174397465-174397487 CTGCCCTTGTCATTCATTCCAGG - Intergenic
1001886948 5:175301259-175301281 CTGTACTTGCCAATCTTCCCAGG + Intergenic
1002712964 5:181205929-181205951 CCGCCCTTGCCAATGTCACCGGG + Intergenic
1006914895 6:37587862-37587884 CTTCCCTGGCCAGTCACTCCCGG + Intergenic
1006917428 6:37603457-37603479 CTGCCCTTCCCAAGGACCCATGG + Intergenic
1007712445 6:43833385-43833407 CAGCCCCTGCCACTCACTCCTGG + Intergenic
1010195453 6:73235342-73235364 CTCCCCTTGCTCATCACCCCCGG + Intronic
1011260193 6:85462245-85462267 CTGAGCTTTCCAAGCACCCCCGG + Intronic
1012500117 6:99879199-99879221 CTGCCCCTTCCAAAGACCCCAGG + Intergenic
1013419017 6:109949470-109949492 TGGCCCTTGCCACCCACCCCAGG + Intergenic
1014553264 6:122813739-122813761 CTGCCCTTCACACTCTCCCCAGG - Intergenic
1016039003 6:139412485-139412507 CTCCCCCTGCCCCTCACCCCAGG - Intergenic
1017432292 6:154382778-154382800 CTGCCGCTGCCACTCACCACAGG - Intronic
1018550837 6:164997054-164997076 CTGCCCTGGCCCCTCAGCCCCGG + Intergenic
1018595217 6:165471816-165471838 TTCTACTTGCCAATCACCCCTGG + Intronic
1019761410 7:2815508-2815530 ATGCCTCTGCCAACCACCCCAGG + Intronic
1022291600 7:29009785-29009807 TTGCCCTTCCTAATTACCCCTGG - Intronic
1022334358 7:29408308-29408330 CTGCACTTGACAATCACCTGAGG - Intronic
1022452262 7:30525955-30525977 CTGCCCTTGCCAATCTCCCCAGG - Intronic
1023794602 7:43781302-43781324 CTCCCCTTGCTACTGACCCCTGG + Intronic
1023860816 7:44216811-44216833 CTGACCTCTCCATTCACCCCCGG - Intergenic
1026610735 7:71857662-71857684 TGGCACTGGCCAATCACCCCAGG + Intronic
1028460274 7:91084644-91084666 CTGCCCTTGGCCATCACCAGGGG - Intronic
1030116422 7:106065362-106065384 CTGCCCTTGCCAAGCCCACTGGG + Intergenic
1031547586 7:123068862-123068884 CTGCTCTTGCCACTCACCTCTGG - Intergenic
1036178908 8:6566662-6566684 ATGGCCTTGCCAATCACACAGGG - Intronic
1038381718 8:27101538-27101560 CTCCCTTTGCCCCTCACCCCCGG - Intergenic
1042252992 8:66775141-66775163 CCGCCCTCACCAATCACCACCGG - Intronic
1044233269 8:89803558-89803580 CTCCCCTTGCCTTCCACCCCCGG + Intergenic
1047504275 8:125466529-125466551 CTGCTCTGGCAAATCACCCCTGG - Intergenic
1047536732 8:125726815-125726837 CTGCCTTTGAGAAACACCCCTGG + Intergenic
1048212971 8:132471403-132471425 CTCCCCTTGGCAATCATCTCAGG - Intronic
1048489485 8:134879552-134879574 CTGCCCTGGCCAATCAAGACAGG - Intergenic
1049359357 8:142204634-142204656 CTGCCCCTGCCCCCCACCCCCGG - Intergenic
1050267413 9:3905649-3905671 TTTCCCTTGACGATCACCCCTGG + Intronic
1051481710 9:17568978-17569000 CTGCCCTTGCAAACCAACACAGG + Intergenic
1053014644 9:34654874-34654896 CTGCCCTTGGCGCCCACCCCTGG - Intronic
1054935067 9:70678058-70678080 CTGCCCCTGCCACACACACCAGG - Intronic
1057168626 9:92947526-92947548 CTTCCCGCGCCAATCAGCCCAGG - Exonic
1060439722 9:123627238-123627260 CTGGCCTTGCCACTGACCCTGGG - Intronic
1061017361 9:127989602-127989624 CTGCCCTGACCACCCACCCCAGG - Intergenic
1061065560 9:128275694-128275716 CCGCCCTCGCCAGTCGCCCCCGG - Intronic
1061803034 9:133122370-133122392 CTGGCCATGCCAACCTCCCCAGG + Intronic
1188003559 X:25002796-25002818 CTTCCCTTTCCCATCACCCTGGG + Intergenic
1188225501 X:27592351-27592373 CTGGCCCTGCCATTCTCCCCAGG + Intronic
1190161912 X:48038205-48038227 CTCCCCTTGCCTCTCACCCCTGG - Intronic
1190282543 X:48940554-48940576 CAGCCCTTGCCACTCCCCCATGG + Intronic
1190511072 X:51174984-51175006 CTCCCCTTGCCCCCCACCCCTGG - Intergenic
1191849877 X:65578344-65578366 CTGCTCTTGAAAGTCACCCCTGG - Intergenic
1197643497 X:128992799-128992821 CTGCTCTTGCCTACCACACCGGG - Intergenic
1199880958 X:151974199-151974221 CTGCCCTGGCCGGTCACCCCGGG + Intronic
1202366340 Y:24168454-24168476 TTGCCCTTGCCAGTCACCACAGG + Intergenic
1202366392 Y:24168609-24168631 CCGCCCTGGCCAGTCATCCCTGG + Intergenic
1202374116 Y:24218035-24218057 CTGCCCTCACCAGTCATCCCTGG - Intergenic
1202374163 Y:24218190-24218212 TTGCCCTTGCCAATCACCACAGG - Intergenic
1202496618 Y:25451930-25451952 TTGCCCTTGCCAATCACCACAGG + Intergenic
1202496665 Y:25452085-25452107 CTGCCCTCACCAGTCATCCCTGG + Intergenic
1202504441 Y:25501669-25501691 TTGCCCTTGCCAGTCACCACAGG - Intergenic