ID: 1130474771

View in Genome Browser
Species Human (GRCh38)
Location 15:84254856-84254878
Sequence CTGGTTTTCCGTGGTTTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130474765_1130474771 0 Left 1130474765 15:84254833-84254855 CCGCACCCGGCCAACTTGTTTTT No data
Right 1130474771 15:84254856-84254878 CTGGTTTTCCGTGGTTTTCATGG No data
1130474764_1130474771 3 Left 1130474764 15:84254830-84254852 CCACCGCACCCGGCCAACTTGTT No data
Right 1130474771 15:84254856-84254878 CTGGTTTTCCGTGGTTTTCATGG No data
1130474767_1130474771 -5 Left 1130474767 15:84254838-84254860 CCCGGCCAACTTGTTTTTCTGGT No data
Right 1130474771 15:84254856-84254878 CTGGTTTTCCGTGGTTTTCATGG No data
1130474760_1130474771 30 Left 1130474760 15:84254803-84254825 CCAAAGTGCCCAGATTGCAGGCG No data
Right 1130474771 15:84254856-84254878 CTGGTTTTCCGTGGTTTTCATGG No data
1130474769_1130474771 -10 Left 1130474769 15:84254843-84254865 CCAACTTGTTTTTCTGGTTTTCC No data
Right 1130474771 15:84254856-84254878 CTGGTTTTCCGTGGTTTTCATGG No data
1130474761_1130474771 22 Left 1130474761 15:84254811-84254833 CCCAGATTGCAGGCGTGAGCCAC 0: 3
1: 134
2: 1956
3: 4850
4: 4885
Right 1130474771 15:84254856-84254878 CTGGTTTTCCGTGGTTTTCATGG No data
1130474768_1130474771 -6 Left 1130474768 15:84254839-84254861 CCGGCCAACTTGTTTTTCTGGTT No data
Right 1130474771 15:84254856-84254878 CTGGTTTTCCGTGGTTTTCATGG No data
1130474762_1130474771 21 Left 1130474762 15:84254812-84254834 CCAGATTGCAGGCGTGAGCCACC 0: 4
1: 32
2: 91
3: 278
4: 537
Right 1130474771 15:84254856-84254878 CTGGTTTTCCGTGGTTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130474771 Original CRISPR CTGGTTTTCCGTGGTTTTCA TGG Intergenic
No off target data available for this crispr