ID: 1130479782

View in Genome Browser
Species Human (GRCh38)
Location 15:84350673-84350695
Sequence CTGCCCTTGCCAATCACCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130479771_1130479782 19 Left 1130479771 15:84350631-84350653 CCTAGTCAGTCAGCCCCACCCCT No data
Right 1130479782 15:84350673-84350695 CTGCCCTTGCCAATCACCCCAGG No data
1130479769_1130479782 29 Left 1130479769 15:84350621-84350643 CCAACCAAAGCCTAGTCAGTCAG No data
Right 1130479782 15:84350673-84350695 CTGCCCTTGCCAATCACCCCAGG No data
1130479774_1130479782 4 Left 1130479774 15:84350646-84350668 CCACCCCTTCAGCAAGCAGCCCA No data
Right 1130479782 15:84350673-84350695 CTGCCCTTGCCAATCACCCCAGG No data
1130479776_1130479782 0 Left 1130479776 15:84350650-84350672 CCCTTCAGCAAGCAGCCCAGTCC No data
Right 1130479782 15:84350673-84350695 CTGCCCTTGCCAATCACCCCAGG No data
1130479768_1130479782 30 Left 1130479768 15:84350620-84350642 CCCAACCAAAGCCTAGTCAGTCA No data
Right 1130479782 15:84350673-84350695 CTGCCCTTGCCAATCACCCCAGG No data
1130479772_1130479782 6 Left 1130479772 15:84350644-84350666 CCCCACCCCTTCAGCAAGCAGCC No data
Right 1130479782 15:84350673-84350695 CTGCCCTTGCCAATCACCCCAGG No data
1130479777_1130479782 -1 Left 1130479777 15:84350651-84350673 CCTTCAGCAAGCAGCCCAGTCCC No data
Right 1130479782 15:84350673-84350695 CTGCCCTTGCCAATCACCCCAGG No data
1130479773_1130479782 5 Left 1130479773 15:84350645-84350667 CCCACCCCTTCAGCAAGCAGCCC No data
Right 1130479782 15:84350673-84350695 CTGCCCTTGCCAATCACCCCAGG No data
1130479775_1130479782 1 Left 1130479775 15:84350649-84350671 CCCCTTCAGCAAGCAGCCCAGTC No data
Right 1130479782 15:84350673-84350695 CTGCCCTTGCCAATCACCCCAGG No data
1130479770_1130479782 25 Left 1130479770 15:84350625-84350647 CCAAAGCCTAGTCAGTCAGCCCC No data
Right 1130479782 15:84350673-84350695 CTGCCCTTGCCAATCACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130479782 Original CRISPR CTGCCCTTGCCAATCACCCC AGG Intergenic
No off target data available for this crispr