ID: 1130482187

View in Genome Browser
Species Human (GRCh38)
Location 15:84368912-84368934
Sequence CTGGTTTTCCGTGGTTTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130482184_1130482187 -6 Left 1130482184 15:84368895-84368917 CCGGCCAACTTGTTTTTCTGGTT No data
Right 1130482187 15:84368912-84368934 CTGGTTTTCCGTGGTTTTCATGG No data
1130482178_1130482187 21 Left 1130482178 15:84368868-84368890 CCAGATTGCAGGCGTGAGCCACC 0: 4
1: 32
2: 91
3: 278
4: 537
Right 1130482187 15:84368912-84368934 CTGGTTTTCCGTGGTTTTCATGG No data
1130482181_1130482187 0 Left 1130482181 15:84368889-84368911 CCGCACCCGGCCAACTTGTTTTT No data
Right 1130482187 15:84368912-84368934 CTGGTTTTCCGTGGTTTTCATGG No data
1130482183_1130482187 -5 Left 1130482183 15:84368894-84368916 CCCGGCCAACTTGTTTTTCTGGT No data
Right 1130482187 15:84368912-84368934 CTGGTTTTCCGTGGTTTTCATGG No data
1130482177_1130482187 22 Left 1130482177 15:84368867-84368889 CCCAGATTGCAGGCGTGAGCCAC 0: 3
1: 134
2: 1956
3: 4850
4: 4885
Right 1130482187 15:84368912-84368934 CTGGTTTTCCGTGGTTTTCATGG No data
1130482176_1130482187 30 Left 1130482176 15:84368859-84368881 CCAAAGTGCCCAGATTGCAGGCG No data
Right 1130482187 15:84368912-84368934 CTGGTTTTCCGTGGTTTTCATGG No data
1130482185_1130482187 -10 Left 1130482185 15:84368899-84368921 CCAACTTGTTTTTCTGGTTTTCC No data
Right 1130482187 15:84368912-84368934 CTGGTTTTCCGTGGTTTTCATGG No data
1130482180_1130482187 3 Left 1130482180 15:84368886-84368908 CCACCGCACCCGGCCAACTTGTT No data
Right 1130482187 15:84368912-84368934 CTGGTTTTCCGTGGTTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130482187 Original CRISPR CTGGTTTTCCGTGGTTTTCA TGG Intergenic
No off target data available for this crispr