ID: 1130483914

View in Genome Browser
Species Human (GRCh38)
Location 15:84387106-84387128
Sequence CTGCCCTTGCCAATCACCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130483901_1130483914 30 Left 1130483901 15:84387053-84387075 CCCCACCAAAGTCTTCTCAGTCA No data
Right 1130483914 15:84387106-84387128 CTGCCCTTGCCAATCACCCCAGG No data
1130483908_1130483914 1 Left 1130483908 15:84387082-84387104 CCCCTTCAGCAAGCCGCTCAGTC No data
Right 1130483914 15:84387106-84387128 CTGCCCTTGCCAATCACCCCAGG No data
1130483910_1130483914 -1 Left 1130483910 15:84387084-84387106 CCTTCAGCAAGCCGCTCAGTCCC No data
Right 1130483914 15:84387106-84387128 CTGCCCTTGCCAATCACCCCAGG No data
1130483907_1130483914 4 Left 1130483907 15:84387079-84387101 CCACCCCTTCAGCAAGCCGCTCA No data
Right 1130483914 15:84387106-84387128 CTGCCCTTGCCAATCACCCCAGG No data
1130483904_1130483914 25 Left 1130483904 15:84387058-84387080 CCAAAGTCTTCTCAGTCAGCCCC No data
Right 1130483914 15:84387106-84387128 CTGCCCTTGCCAATCACCCCAGG No data
1130483902_1130483914 29 Left 1130483902 15:84387054-84387076 CCCACCAAAGTCTTCTCAGTCAG No data
Right 1130483914 15:84387106-84387128 CTGCCCTTGCCAATCACCCCAGG No data
1130483909_1130483914 0 Left 1130483909 15:84387083-84387105 CCCTTCAGCAAGCCGCTCAGTCC No data
Right 1130483914 15:84387106-84387128 CTGCCCTTGCCAATCACCCCAGG No data
1130483905_1130483914 6 Left 1130483905 15:84387077-84387099 CCCCACCCCTTCAGCAAGCCGCT No data
Right 1130483914 15:84387106-84387128 CTGCCCTTGCCAATCACCCCAGG No data
1130483906_1130483914 5 Left 1130483906 15:84387078-84387100 CCCACCCCTTCAGCAAGCCGCTC No data
Right 1130483914 15:84387106-84387128 CTGCCCTTGCCAATCACCCCAGG No data
1130483903_1130483914 28 Left 1130483903 15:84387055-84387077 CCACCAAAGTCTTCTCAGTCAGC No data
Right 1130483914 15:84387106-84387128 CTGCCCTTGCCAATCACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130483914 Original CRISPR CTGCCCTTGCCAATCACCCC AGG Intergenic
No off target data available for this crispr