ID: 1130485471

View in Genome Browser
Species Human (GRCh38)
Location 15:84396045-84396067
Sequence CTGCCTGGGTGCCGTGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130485471_1130485484 30 Left 1130485471 15:84396045-84396067 CCTCTCCCACGGCACCCAGGCAG No data
Right 1130485484 15:84396098-84396120 CCCTCAGGCTTCCGCTTCTCTGG No data
1130485471_1130485479 15 Left 1130485471 15:84396045-84396067 CCTCTCCCACGGCACCCAGGCAG No data
Right 1130485479 15:84396083-84396105 GACCAATGCTCAACCCCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130485471 Original CRISPR CTGCCTGGGTGCCGTGGGAG AGG (reversed) Intergenic
No off target data available for this crispr