ID: 1130486450

View in Genome Browser
Species Human (GRCh38)
Location 15:84400949-84400971
Sequence GACCCCTCTGGAGGTACTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130486443_1130486450 0 Left 1130486443 15:84400926-84400948 CCATTTTCAAGGGCTGGCAGGGG No data
Right 1130486450 15:84400949-84400971 GACCCCTCTGGAGGTACTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130486450 Original CRISPR GACCCCTCTGGAGGTACTTG GGG Intergenic
No off target data available for this crispr