ID: 1130491988

View in Genome Browser
Species Human (GRCh38)
Location 15:84437456-84437478
Sequence CTGCCCTTGCCAATCACCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130491988_1130491996 4 Left 1130491988 15:84437456-84437478 CCTGGGGTGATTGGCAAGGGCAG No data
Right 1130491996 15:84437483-84437505 TGGGCTGCTTGCTGAAGGGGTGG No data
1130491988_1130491993 -1 Left 1130491988 15:84437456-84437478 CCTGGGGTGATTGGCAAGGGCAG No data
Right 1130491993 15:84437478-84437500 GGGACTGGGCTGCTTGCTGAAGG No data
1130491988_1130492002 30 Left 1130491988 15:84437456-84437478 CCTGGGGTGATTGGCAAGGGCAG No data
Right 1130492002 15:84437509-84437531 TGACTGACTAGGCTTTGGTTGGG No data
1130491988_1130491995 1 Left 1130491988 15:84437456-84437478 CCTGGGGTGATTGGCAAGGGCAG No data
Right 1130491995 15:84437480-84437502 GACTGGGCTGCTTGCTGAAGGGG No data
1130491988_1130491998 6 Left 1130491988 15:84437456-84437478 CCTGGGGTGATTGGCAAGGGCAG No data
Right 1130491998 15:84437485-84437507 GGCTGCTTGCTGAAGGGGTGGGG No data
1130491988_1130491997 5 Left 1130491988 15:84437456-84437478 CCTGGGGTGATTGGCAAGGGCAG No data
Right 1130491997 15:84437484-84437506 GGGCTGCTTGCTGAAGGGGTGGG No data
1130491988_1130492000 25 Left 1130491988 15:84437456-84437478 CCTGGGGTGATTGGCAAGGGCAG No data
Right 1130492000 15:84437504-84437526 GGGGCTGACTGACTAGGCTTTGG No data
1130491988_1130491994 0 Left 1130491988 15:84437456-84437478 CCTGGGGTGATTGGCAAGGGCAG No data
Right 1130491994 15:84437479-84437501 GGACTGGGCTGCTTGCTGAAGGG No data
1130491988_1130492001 29 Left 1130491988 15:84437456-84437478 CCTGGGGTGATTGGCAAGGGCAG No data
Right 1130492001 15:84437508-84437530 CTGACTGACTAGGCTTTGGTTGG No data
1130491988_1130491999 19 Left 1130491988 15:84437456-84437478 CCTGGGGTGATTGGCAAGGGCAG No data
Right 1130491999 15:84437498-84437520 AGGGGTGGGGCTGACTGACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130491988 Original CRISPR CTGCCCTTGCCAATCACCCC AGG (reversed) Intergenic
No off target data available for this crispr