ID: 1130493706

View in Genome Browser
Species Human (GRCh38)
Location 15:84451358-84451380
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 793
Summary {0: 9, 1: 4, 2: 40, 3: 110, 4: 630}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130493706_1130493709 27 Left 1130493706 15:84451358-84451380 CCGATCTACATTTTTATTTACAG 0: 9
1: 4
2: 40
3: 110
4: 630
Right 1130493709 15:84451408-84451430 ATCCTGAAGCTGTTTGATTTCGG No data
1130493706_1130493710 28 Left 1130493706 15:84451358-84451380 CCGATCTACATTTTTATTTACAG 0: 9
1: 4
2: 40
3: 110
4: 630
Right 1130493710 15:84451409-84451431 TCCTGAAGCTGTTTGATTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130493706 Original CRISPR CTGTAAATAAAAATGTAGAT CGG (reversed) Intergenic
900342735 1:2196395-2196417 CTATAAATAAAAAATTAGCTGGG + Intronic
900749267 1:4384131-4384153 ATGTGAATAGAAAGGTAGATGGG + Intergenic
901109009 1:6780617-6780639 CTAAAAATAAAAATTTAGCTGGG - Intergenic
901585014 1:10282903-10282925 CTGTTAATAAAGATGAAGTTTGG + Intronic
901946076 1:12705018-12705040 CAATTAATAACAATGTAGATTGG - Intergenic
902052133 1:13572116-13572138 CAATTAATAAAAATGTACATTGG + Intergenic
902706083 1:18205729-18205751 ATTCTAATAAAAATGTAGATTGG + Intronic
904504538 1:30939949-30939971 CTGTGAACAAAAATGTAAACAGG + Intronic
904569781 1:31454684-31454706 CAATTAATAAAAATGTAGATTGG - Intergenic
904712807 1:32443669-32443691 CAATGAATAAAAATGTAGATTGG - Intergenic
904759016 1:32787947-32787969 CTGAAAATAAAAAATTAGCTGGG + Intronic
905161155 1:36035730-36035752 CTGTGAATAAAACTTTGGATTGG + Intronic
905619919 1:39435903-39435925 CTTGGAATAAAAATGAAGATAGG - Intronic
905750410 1:40457738-40457760 GTGTAAATCTAAATGTACATGGG - Intronic
905881912 1:41469400-41469422 ATGTATATATAAGTGTAGATTGG - Intergenic
906430787 1:45754393-45754415 CTATAAATAAAAATGTAGACTGG - Intergenic
906462299 1:46044233-46044255 CTAAAAATAAAAAAGTAGCTGGG - Intronic
906497169 1:46312987-46313009 CTGTCAGTAAAAGTGTAAATTGG + Intronic
906715872 1:47968765-47968787 AAGTAAATAAAATAGTAGATTGG - Intronic
906838206 1:49107194-49107216 CTGAAAGTAAAAATATAGAATGG - Intronic
907144166 1:52217989-52218011 CTATAAACAAAAACGTAGACTGG - Intronic
907253557 1:53160582-53160604 CTGTAAATAATTATGTATAAAGG - Intergenic
907833522 1:58087706-58087728 CTGAAAATAAAAAGTTAGATGGG + Intronic
908588515 1:65602658-65602680 CTACAAATAAAAATATAAATTGG - Intronic
909082966 1:71135890-71135912 CTGTAAATGAGAATGTAAATTGG + Intergenic
909365883 1:74821314-74821336 ATGTAAATAATAATAAAGATGGG + Intergenic
909382077 1:75010236-75010258 TTTTCCATAAAAATGTAGATTGG + Intergenic
909589774 1:77334213-77334235 CTGGATATAAAAATGTAGGTTGG + Intronic
909775227 1:79476876-79476898 ATGTAATTTAAAATGGAGATAGG + Intergenic
909783450 1:79579398-79579420 CAGTAAAAAAAAATGTAAAAAGG + Intergenic
909928841 1:81471672-81471694 TTGTGAAGAAAAATGTATATAGG + Intronic
909947481 1:81679742-81679764 TTGTTAATAAATATGTAGACTGG + Intronic
910701366 1:90078045-90078067 CTGTTGATGAGAATGTAGATTGG - Intergenic
911437110 1:97875367-97875389 CTGTTAATAAACACATAGATGGG + Intronic
911875811 1:103161441-103161463 CTAAAAATAAAAAAGTAGCTGGG + Intergenic
911959044 1:104275256-104275278 ATGTAAATAAAAATGCAAAGAGG - Intergenic
912856870 1:113177500-113177522 CTGCAAATTAAAATGTCTATGGG - Intergenic
913231986 1:116747553-116747575 ATGTAAACAAAAATGTAGACTGG + Intergenic
913698598 1:121352787-121352809 CTATATATAAGAATATAGATTGG + Intronic
914002986 1:143708428-143708450 TTGTTCCTAAAAATGTAGATTGG - Intergenic
914138948 1:144927248-144927270 CTATATATAAGAATATAGATTGG - Intronic
914816767 1:151069232-151069254 CTGTAAATACCAATATGGATAGG + Intronic
915048995 1:153048111-153048133 CTGTCATTAAAAATGTATGTGGG - Intergenic
915431966 1:155873776-155873798 ATTTAAATTAAAATGTAAATAGG + Intronic
915762987 1:158334116-158334138 CTGTAAATTTAAATTTAGTTAGG + Intergenic
916839964 1:168589751-168589773 ATGTCAATAAAAATGTTGAAAGG + Intergenic
916874804 1:168958018-168958040 CAGTAAATACAAATGAAGCTTGG + Intergenic
917307563 1:173641860-173641882 CTATAAATAAAAATATAGACTGG + Intronic
917311604 1:173684883-173684905 CAATTAATAAAAATGTAGATTGG - Intergenic
917703550 1:177606335-177606357 ATGTAAATACAACTGGAGATAGG + Intergenic
918484531 1:185015301-185015323 CTGGAAATACAGATGCAGATTGG - Intergenic
918618996 1:186581113-186581135 TTGAAAATAAAAATGTACTTTGG + Intergenic
918703945 1:187638202-187638224 GTATTAATAAAAATGTAGATTGG + Intergenic
918706430 1:187668525-187668547 ATTTTAATAAAAATGTAAATAGG + Intergenic
919173364 1:193987314-193987336 ATGTAAATATAATTGTAGAAAGG - Intergenic
919203039 1:194383081-194383103 TTGTCACTAAAAATCTAGATAGG + Intergenic
919380901 1:196859554-196859576 CTGTTGATATAAATGTATATTGG - Intronic
920486004 1:206371428-206371450 CTATATATAAGAATATAGATTGG + Intronic
920951129 1:210572734-210572756 ATATAAAAAAAAATGTAGCTGGG + Intronic
921151679 1:212407911-212407933 CTAAAAATAAAAAAGTAGCTGGG + Intronic
921376790 1:214482794-214482816 TTTTAAATAAAAATGTAAAAAGG - Intronic
921413101 1:214857869-214857891 CTGGGAAAAAAAATGTAGAAAGG + Intergenic
921474478 1:215590030-215590052 CTGCAAGTAAAAATGTAAAAAGG - Intronic
921729299 1:218559301-218559323 TTGTAAGGAGAAATGTAGATGGG + Intergenic
922312805 1:224411864-224411886 AAGTAAAAAAAAATGTAGCTGGG - Intronic
922526068 1:226305167-226305189 CTTTAAAAAAAAATAAAGATAGG + Intronic
922628816 1:227082810-227082832 CTGTAAATAACACTGTAAGTTGG + Intronic
922883583 1:229001040-229001062 CTGAAAATAAAAATTTAGCTGGG + Intergenic
923421942 1:233824400-233824422 CCTTAAATATAAATGTAAATGGG + Intergenic
923633814 1:235674551-235674573 CTGCAAGCAAAAATGTAGACTGG + Intronic
1063602176 10:7492219-7492241 ATGTAAATAAAAATGCTGAGTGG + Intergenic
1063757361 10:9028365-9028387 CTTTAAAAAAAAAAGGAGATTGG - Intergenic
1063845931 10:10126759-10126781 CTTTAAAAAGAAATGCAGATTGG - Intergenic
1063863406 10:10337663-10337685 CTGAAAATAAAGATATAGAAAGG - Intergenic
1063868227 10:10389974-10389996 CAGTAGATAAAAATCTAGGTAGG - Intergenic
1064671237 10:17716755-17716777 AGGTAAAGAAAAATGTATATGGG - Intergenic
1064756599 10:18577045-18577067 GTGACAATAAAAATGTAGATTGG + Intronic
1065843807 10:29728443-29728465 CTGTACATAAAAACTTTGATAGG + Intronic
1066077890 10:31898548-31898570 CTGCATATAAAAATGCAGTTGGG - Intronic
1066079170 10:31912569-31912591 CTTTAACTAAAACTCTAGATTGG - Intronic
1066168135 10:32810284-32810306 CTGTAAAGAAACATATAGACTGG + Intronic
1066511211 10:36098704-36098726 CTTTAAAGAAAAAAGTACATCGG + Intergenic
1066533770 10:36367987-36368009 CTGGAAATAAAGATGAAGAAGGG + Intergenic
1068189617 10:53634497-53634519 ATGTAAAAAGAACTGTAGATGGG - Intergenic
1068603604 10:58981104-58981126 CTGTAAATAAAAAAGCTGCTTGG + Intergenic
1070992784 10:80746932-80746954 CTGTAAATAAAAATGTGAGTTGG + Intergenic
1071029290 10:81155633-81155655 CTATAGATATAAATGTAGATAGG + Intergenic
1071282978 10:84119628-84119650 CAATTAATAAAAATGTAGATTGG - Intergenic
1071347822 10:84709515-84709537 CGGTAGATAAAAATATATATTGG - Intergenic
1071788882 10:88933481-88933503 CTTTAAAAAAAAATAGAGATGGG - Intronic
1072123227 10:92422398-92422420 CTATAAATAAAAAATTAGCTGGG + Intergenic
1072334911 10:94389369-94389391 CAGTTAATAAAAATGTAAATTGG + Intergenic
1072712950 10:97729713-97729735 CTGTCAATGAAAATGTAAAATGG - Intergenic
1073052311 10:100675441-100675463 CTTTAAATAAACATATATATAGG + Intergenic
1073157150 10:101356161-101356183 CTAAAAATAAAAAATTAGATGGG - Intronic
1073243509 10:102073637-102073659 CTTTAAATAAAAATTCAGGTGGG + Intergenic
1073261642 10:102195130-102195152 CTATTAACAAAAAAGTAGATTGG - Intergenic
1073356921 10:102862600-102862622 ATGTAAATCAAAATTTATATTGG - Intronic
1073523797 10:104160325-104160347 CAGTGAATAAAAATGTGGACAGG + Intronic
1073534477 10:104263197-104263219 CTGTAAACAAAAATGTTTAGGGG - Intronic
1073832087 10:107396400-107396422 TGGTAAATAAAAATCTAGAGTGG - Intergenic
1074167344 10:110894946-110894968 GTGTAAATAGAGAAGTAGATGGG + Intronic
1074280505 10:112047256-112047278 CTGTAAATAAAAATATTTTTGGG + Intergenic
1074306027 10:112279338-112279360 CTGTGAATGAAAATATTGATTGG + Intergenic
1075224639 10:120616556-120616578 CTTTAAATATAAAGGCAGATAGG + Intergenic
1075996554 10:126881542-126881564 CTGAAATTAAAAATAAAGATGGG + Intergenic
1076198770 10:128540990-128541012 CTGTAAAAAAAAGTCCAGATTGG - Intergenic
1079309348 11:19350546-19350568 ATGTCAATAACAATGTAAATGGG - Intergenic
1080781790 11:35436215-35436237 CTGTAAACAAATATCTACATGGG - Intronic
1081041717 11:38222271-38222293 CAATAAATAAAAATGTAGATTGG - Intergenic
1081380494 11:42408713-42408735 CTGTTAATAATAATGAAGACTGG - Intergenic
1082197126 11:49320063-49320085 ATGTAAATAAATTTGTAGTTTGG - Intergenic
1082199814 11:49352403-49352425 CTGTAAGTAAAAATACAAATAGG - Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1084883342 11:72187676-72187698 TTTTAAATAAAAATATAAATAGG + Intergenic
1085900690 11:80696620-80696642 CTGCAGGTAAAAATGTAAATTGG - Intergenic
1086194597 11:84122157-84122179 CTGAAAATACAAATTTAGTTGGG + Intronic
1086595713 11:88568095-88568117 CTGAAATTAGAAAGGTAGATGGG - Intronic
1086655854 11:89353791-89353813 CTGTAAGTAAAAATACAAATAGG + Intronic
1086658696 11:89388057-89388079 ATGTAAATAAATTTGTAGTTTGG + Intronic
1086715479 11:90056258-90056280 CTTTAAATAAGAATCCAGATGGG - Intergenic
1086952910 11:92909158-92909180 CTCTAAAAAAACATGTAGAATGG - Intergenic
1086973350 11:93106738-93106760 TAGTTAATAAAAATGTAAATTGG - Intergenic
1086987703 11:93268031-93268053 CAATTAATAAAAACGTAGATTGG + Intergenic
1087241381 11:95785035-95785057 GGGTAACTAAAACTGTAGATAGG - Intronic
1087419450 11:97902491-97902513 CTGAAAATAAAAAGGTACACAGG + Intergenic
1087456665 11:98395447-98395469 CAATTAATAAAAATGTAGATCGG - Intergenic
1087569893 11:99912696-99912718 CTGTAACTAGAACTGTAGCTTGG - Intronic
1087606047 11:100379441-100379463 CTGTTGGTGAAAATGTAGATTGG + Intergenic
1087718304 11:101633939-101633961 GTATCAATAAAAATGTACATAGG + Intronic
1087757565 11:102071298-102071320 CTGTAAATAAAACAGTAAAAAGG - Intronic
1087894925 11:103576560-103576582 CAGTTAATAAAAATGTAGATTGG + Intergenic
1088016569 11:105067909-105067931 TTGCAGATAAAAATGTAGAAAGG + Intronic
1088019122 11:105097830-105097852 TTTTAGATAAAAATGTAGAAAGG + Intronic
1088065417 11:105712126-105712148 TTATAAATAAATATGTAAATAGG + Intronic
1088353329 11:108914142-108914164 ATGTAAATAAACATTTATATTGG + Intronic
1088704005 11:112444748-112444770 CTGGGTATAAAAATGTAGATTGG + Intergenic
1088946820 11:114522254-114522276 CTGCGAATAAAAATGTCAATGGG + Exonic
1089545501 11:119221378-119221400 TTTTAAATAAAAATAGAGATGGG - Intronic
1091073926 11:132596315-132596337 ATAGAAATAAAAATATAGATAGG - Intronic
1091878593 12:3958235-3958257 ATGTAATCAAAATTGTAGATGGG - Intergenic
1092333294 12:7605400-7605422 CTATTAATAAAAATGTGGATTGG + Intergenic
1092586175 12:9903740-9903762 CTATAAATAAAAATGTAAATTGG - Intronic
1092632696 12:10400153-10400175 CTGTTAATGAAAATGTAAAATGG + Intronic
1092908087 12:13120526-13120548 CTGGAAATAAGTATGTAGAATGG + Intronic
1093356901 12:18177468-18177490 CAATTAATAAAAATGTAAATTGG + Intronic
1093409463 12:18846732-18846754 CTGTAAATAAAAATATTAAATGG + Intergenic
1093520396 12:20043673-20043695 CAAGAAATAAAAATGTAGAGGGG - Intergenic
1093594010 12:20940272-20940294 CAGTTAATAAAAATGTAGATTGG - Intergenic
1093819959 12:23602747-23602769 CTGTAAAGAAAAATGTACTTTGG - Intronic
1094235915 12:28166016-28166038 CTGTAAATAAATAAATAGCTAGG + Intronic
1094302374 12:28979204-28979226 CTGTAAATAAAAAGCTTGTTTGG + Intergenic
1095187295 12:39215496-39215518 TTCTAAATAAAAATAGAGATGGG - Intergenic
1095300214 12:40575534-40575556 CTGTAATTAAAAGTATATATAGG - Intergenic
1095456446 12:42390835-42390857 TTGTATATAAAAATAGAGATGGG + Intronic
1095578887 12:43772003-43772025 CTGTAAGTTATAATGAAGATGGG - Intronic
1095677875 12:44940520-44940542 CTTTAAATAAAAATCTAAAGAGG + Intergenic
1095722511 12:45415844-45415866 ATGTAACTAAAACTGTGGATGGG - Intronic
1096207828 12:49738274-49738296 CAGTTAATAAAAATGTAGATTGG + Intronic
1096458305 12:51805987-51806009 CTGAAAATAAAAAATTAGCTGGG - Intronic
1096470594 12:51873232-51873254 TTGTAAACAAAAATGTACACTGG + Intergenic
1096542423 12:52315273-52315295 CTGAAAAGGAAAATGTAGACTGG - Intronic
1097999930 12:65930221-65930243 GTGTAAATAAAACTTTAGAAAGG + Intronic
1098083053 12:66810123-66810145 CAGAAAATAAAAAGGTAGACAGG + Intergenic
1098248497 12:68544731-68544753 CAGTTAATGAAAATGTAGATTGG + Intergenic
1098995288 12:77112237-77112259 CTTTAAATATAAAAATAGATAGG - Intergenic
1099923767 12:88992578-88992600 CTATATATAAAAATATATATTGG + Intergenic
1100318732 12:93469629-93469651 CTCTAAAAAAAAATGTGGGTTGG + Intronic
1101015038 12:100491444-100491466 TTGTAAATAAAAATGAAGTCTGG - Intronic
1101617861 12:106355553-106355575 CTAAAAATAAAAATTTAGACGGG + Intergenic
1102550316 12:113686898-113686920 CTTTAAATTAAAATGAAAATTGG + Intergenic
1102999479 12:117374502-117374524 CTGTAAATAAATAAATAAATGGG + Intronic
1104203382 12:126613990-126614012 CTATGAATAAAAATGTAGCTTGG - Intergenic
1105342133 13:19537392-19537414 CTAAAAATAAAAATTTAGCTGGG - Intergenic
1105392198 13:19990850-19990872 CTATAGATTAAATTGTAGATAGG - Intronic
1105448544 13:20477985-20478007 ATGTATATAAAAATATATATGGG + Intronic
1106622398 13:31383452-31383474 CTGTTGGTGAAAATGTAGATTGG - Intergenic
1106829907 13:33569262-33569284 TTGTTGATAAAAATGTAGATTGG + Intergenic
1107611736 13:42120941-42120963 CTGTAAGTAAAAAGGAAAATGGG - Intronic
1108185659 13:47886050-47886072 CTTTAAAAAAAAATGGAGTTAGG + Intergenic
1108387221 13:49911028-49911050 AGATAAATATAAATGTAGATAGG - Intergenic
1108863301 13:54889881-54889903 CTTTAAATAAAAATATAGAAGGG + Intergenic
1109088172 13:58003679-58003701 TTATAAATAAAACTGCAGATGGG - Intergenic
1109284030 13:60390801-60390823 TTCTAAATAAAAATGAAGAAAGG - Intergenic
1109336283 13:60999037-60999059 CTGAAAATAAAAAATTAGCTGGG - Intergenic
1110044002 13:70805728-70805750 CTGGATATAAAAATCTAGGTTGG + Intergenic
1110257519 13:73448227-73448249 CTCAAAATAAAAAAGTAAATTGG + Intergenic
1110299465 13:73908778-73908800 CTGTAAAGAAAAATGAAAACCGG - Intronic
1110361491 13:74630432-74630454 CTGAAAGGAAAAATGTAGAAAGG + Intergenic
1110361832 13:74634611-74634633 ATGTAAATAAAAATAAAAATTGG - Intergenic
1110407217 13:75164272-75164294 CTGTATATCAAAAAGTAAATAGG + Intergenic
1110796276 13:79642176-79642198 ATGTATATAAAAATACAGATGGG - Intergenic
1110796924 13:79649751-79649773 CTGTCAGGAAAAATGTAGTTTGG + Intergenic
1110930482 13:81209705-81209727 CTAAAAATAACAATGCAGATAGG - Intergenic
1110944760 13:81398452-81398474 CTGTAAACAAAAATGTTACTGGG - Intergenic
1111725537 13:92003442-92003464 CTGAAAAAAAAAATCTCGATTGG - Intronic
1114010247 14:18358700-18358722 GTGACAATAAAAACGTAGATTGG + Intergenic
1114222486 14:20709242-20709264 ATGTTACTAAAAATGTGGATAGG - Intergenic
1114235923 14:20823771-20823793 CAATTAATAAAAATGTAGATTGG - Intergenic
1114787508 14:25617630-25617652 CTGGATATAAAATTATAGATTGG + Intergenic
1114931220 14:27469844-27469866 GTGAAAAAAAAAATGTCGATGGG - Intergenic
1115363849 14:32534103-32534125 CTGTATTTAAAAATGTACAAGGG - Intronic
1115369939 14:32602081-32602103 CTGGAACTAATAATGTAGAGTGG + Intronic
1115600261 14:34949190-34949212 TTGTAAATAAGAATCTAGCTGGG - Intergenic
1115667988 14:35575195-35575217 GGGTCAATAAACATGTAGATAGG - Intronic
1115891542 14:38035296-38035318 CTTTGAATAAAAATCTAGAAAGG - Intronic
1115978906 14:39028334-39028356 ATGAAAATAAAAATGTAAAATGG + Intergenic
1116373355 14:44164936-44164958 CTGTAAAAAAAAATGGGAATGGG - Intergenic
1116554242 14:46283231-46283253 CTGTAAAGATGAATGTAGCTGGG - Intergenic
1116683930 14:48013560-48013582 CTGTACATGGAAATGTAAATTGG + Intergenic
1117179375 14:53176802-53176824 CAATTAATAAAAATGTAAATTGG - Intergenic
1117477711 14:56114001-56114023 CTGTTAATAGACATTTAGATTGG - Intergenic
1117839375 14:59842877-59842899 CTGTAAATAAGAATGCAAAATGG + Intronic
1120136523 14:80876705-80876727 CTGGATATAAAATTCTAGATGGG - Intronic
1120361632 14:83511723-83511745 CTGTAGTTAAACATGTAGTTAGG - Intergenic
1120630473 14:86883934-86883956 CTGAAAATAAAAAATTAGCTGGG - Intergenic
1121268736 14:92623437-92623459 CTATTAATAAAAATGTAGCTTGG - Intronic
1122382969 14:101322875-101322897 GTGACAATAAAAACGTAGATTGG + Intergenic
1123437707 15:20267661-20267683 TTTTAAATAAAAATAGAGATGGG + Intergenic
1124224027 15:27873626-27873648 ATGTAAATATAAATGTCTATAGG - Intronic
1124468098 15:29958208-29958230 GTTAATATAAAAATGTAGATGGG - Intronic
1124792504 15:32742490-32742512 CTGTAAATAAAAATGCCACTGGG - Exonic
1125102210 15:35927266-35927288 CTGTTTATAAAAATGCAAATTGG + Intergenic
1125392509 15:39209421-39209443 ATATATATAAAAATGTACATAGG + Intergenic
1125437612 15:39664410-39664432 CTGTAAATAAATATGATGAATGG - Intronic
1125471122 15:40004854-40004876 ATCTATATAAAAATATAGATTGG - Intronic
1125690480 15:41592132-41592154 CAGTTAACAAAAATGTAGATTGG + Intergenic
1125842506 15:42817326-42817348 CTGTATTTTAAAATGTAGGTAGG - Intronic
1126059804 15:44769563-44769585 CTAAAAATAAAAATTTAGTTGGG - Intergenic
1126627866 15:50702796-50702818 CTGCATATAAAAATGTTCATTGG - Exonic
1126877326 15:53058018-53058040 CTGTTAACAAAAATGTAAGTAGG + Intergenic
1126905855 15:53364297-53364319 CTGTTAATAAGAATGCAAATTGG + Intergenic
1127021019 15:54748848-54748870 CTTTAAACAAAAAAGTAGGTGGG - Intergenic
1127059643 15:55168986-55169008 GTTTAAATAAAAATGTAGCCAGG - Intergenic
1129478682 15:75806061-75806083 CTGAAAATAAAATAGTAGGTGGG - Intergenic
1130263050 15:82374643-82374665 CTGTAAATAAAAATGTAGAGTGG - Intergenic
1130278242 15:82495020-82495042 CTGTAAATAAAAATGTAGATCGG + Intergenic
1130470571 15:84222205-84222227 CTGTAAATAAAAATGTAGATCGG + Intergenic
1130478059 15:84336772-84336794 CTGTAAATAAAAATGTAGATCGG + Intergenic
1130493706 15:84451358-84451380 CTGTAAATAAAAATGTAGATCGG - Intergenic
1130592858 15:85226831-85226853 CTGTAAATAAAAATGTAGATTGG + Intergenic
1131590187 15:93740491-93740513 CTGAAAAAAAAAATGTAGTCTGG + Intergenic
1131721649 15:95175113-95175135 CTGTAAATAAAAATATGGGAGGG + Intergenic
1132016061 15:98318241-98318263 CAGTAAATCAAAATGAAGACCGG + Intergenic
1132492010 16:237075-237097 TTTTAAAAAAATATGTAGATGGG + Intronic
1133388128 16:5387058-5387080 ATAAAAATAAAAATGTAGTTTGG + Intergenic
1133535214 16:6695256-6695278 CTGAAAATAAAAAATTAGCTGGG + Intronic
1133955788 16:10442863-10442885 CTGTTAATAAAAACGTGGATTGG - Intronic
1134142901 16:11737282-11737304 CTGAAAATGAAAAAGTAGCTGGG + Intronic
1134160307 16:11882781-11882803 TTTTAAATAAAAATTGAGATGGG - Intronic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1134437098 16:14270003-14270025 CTGGAAAGAAAAAACTAGATTGG + Intergenic
1135728417 16:24874996-24875018 CTTTAAAAAAAAATAGAGATGGG + Intronic
1136415865 16:30103235-30103257 CTATAAATAAAAATGTAGACTGG + Intergenic
1136846868 16:33583194-33583216 TTTTAAATAAAAATAGAGATGGG - Intergenic
1137517050 16:49155028-49155050 CTGTTGGTAGAAATGTAGATTGG + Intergenic
1137630019 16:49936583-49936605 CTGAAAATAAAAAATTAGCTGGG + Intergenic
1137944553 16:52721313-52721335 GAGTAAATCAATATGTAGATAGG + Intergenic
1137968107 16:52956809-52956831 CTGTATATAAAATTCTAGGTTGG - Intergenic
1138398282 16:56724835-56724857 CTGTATATAAAAAAATAGAAAGG - Intronic
1138938856 16:61764696-61764718 CTGTACATTAAAATGAACATTGG - Intronic
1139184403 16:64788517-64788539 CTGTTAGTAAGAATGTAAATTGG - Intergenic
1139305276 16:65980481-65980503 CTGAAAATAAAAGTGTTGACAGG - Intergenic
1139722612 16:68868916-68868938 GTGAAAATAAAAATGTACTTGGG - Intronic
1139814948 16:69661920-69661942 GTGTATATAAAATTGTATATAGG + Intronic
1139934377 16:70558285-70558307 CTTTAAAAAAAAATAGAGATAGG + Intronic
1140121128 16:72083762-72083784 CTATAAACAAAAACGTAGACTGG + Intronic
1140591885 16:76363321-76363343 CTGAAAATAAAAAATTAGCTGGG - Intronic
1140754828 16:78057671-78057693 CTATAAATAAAAATTTAGGCAGG - Intronic
1141179796 16:81744730-81744752 CTGTAAAAAAAAAATTAGCTGGG - Intronic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1203108576 16_KI270728v1_random:1431849-1431871 TTTTAAATAAAAATAGAGATGGG - Intergenic
1142537200 17:626817-626839 CAGAAAATAAAAATGATGATGGG + Intronic
1142822624 17:2483226-2483248 CTACAAATAAAAATGAAAATAGG + Intronic
1143239341 17:5430674-5430696 CTGGAAATAAAAATAAATATGGG - Intronic
1143526352 17:7475178-7475200 CTGAAAATAAAAAATTAGCTGGG + Intronic
1143682192 17:8484488-8484510 TTGTAAATATAAAAGTATATGGG + Intronic
1143776487 17:9202668-9202690 CTGTAAAAAAAAATTTGGAGTGG + Intronic
1143799790 17:9369085-9369107 CTGGAGCTAAAAATGTAGATAGG - Intronic
1143977363 17:10839879-10839901 ATTTAAATATAAATGTAAATTGG + Intergenic
1144142190 17:12360488-12360510 CTGGAACTTAAAATGTCGATTGG - Intergenic
1144264788 17:13557657-13557679 CTGAAAATACAAAAGTAGAAAGG + Intronic
1146450927 17:32973248-32973270 CTATTAATAAGAATGTGGATTGG + Intronic
1146764277 17:35505133-35505155 CAGTTAATAAAAATGTAGATTGG + Intronic
1146982880 17:37182655-37182677 CAGTGAATACAAATGGAGATTGG + Intronic
1148293289 17:46476197-46476219 CTGGAAGTTAAAATGGAGATAGG + Intergenic
1148315476 17:46693900-46693922 CTGGAAGTTAAAATGGAGATAGG + Exonic
1148658431 17:49307268-49307290 CTAAAAATAAAAATTTAGCTAGG + Intronic
1148828856 17:50415935-50415957 CAGTTAATAAAAATATAAATTGG - Intergenic
1148875698 17:50685848-50685870 CTGAATATAAAAATGAAAATAGG - Intronic
1149155346 17:53622423-53622445 CTGAAAATAAAAAATTAGCTGGG + Intergenic
1150053196 17:61985816-61985838 GTATAAATAAGAATTTAGATAGG - Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1151922603 17:77168846-77168868 CTATAAACAAAAATGTAGACTGG - Intronic
1151948626 17:77333797-77333819 CTTTAAAAAAAAATGAAGTTTGG - Intronic
1152455059 17:80410282-80410304 CAGTTAATAAAAATGTAAATTGG + Intergenic
1153194079 18:2573973-2573995 ATGGAAATCATAATGTAGATAGG + Intronic
1153527485 18:6011512-6011534 GGGTAAATAAAAATTCAGATGGG - Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155513588 18:26601303-26601325 CAGTAAATAAAAGTGTTCATTGG + Intronic
1155711237 18:28882791-28882813 CAGTAAATCCAAATATAGATAGG - Intergenic
1155746061 18:29357517-29357539 CAATTAATAAAATTGTAGATTGG - Intergenic
1155844609 18:30689956-30689978 CTGTTAAAAAAAATGTTTATAGG - Intergenic
1156301395 18:35839507-35839529 CTATTAATAAAAATGTAGATTGG + Intergenic
1156999606 18:43509224-43509246 CTGTAAACAAAAATGTAGACTGG - Intergenic
1157350101 18:46876379-46876401 CTGTAAATAAAAATGTAGATTGG + Intronic
1158179494 18:54697996-54698018 TTGTAAAAATAAATGTAGAAAGG + Intergenic
1158986782 18:62825752-62825774 CTATAATTAAAAATGTATCTGGG - Intronic
1159727408 18:71978891-71978913 GTGTAAGTAAACATGTAAATAGG - Intergenic
1159974222 18:74690791-74690813 CTCTAAATAAAAATCAAAATAGG - Intronic
1161158614 19:2748915-2748937 AAGTAAATAAAAATGTATAAAGG + Intergenic
1162267649 19:9589046-9589068 CAGTTAATAAAAATGTAGATTGG - Intergenic
1162273324 19:9633836-9633858 CTATAAATAAAAATGTAGACTGG + Exonic
1163866977 19:19781716-19781738 CAGTTAATAAAAATGTAAATTGG - Intergenic
1163991964 19:21007148-21007170 CAGTTAATAAAAATGTAGATTGG + Intergenic
1164121455 19:22269078-22269100 CACTTAATAAAAATGTAGATTGG - Intergenic
1164130555 19:22357707-22357729 CAGTTAATAAAAATGTAGATTGG - Intergenic
1164433911 19:28211662-28211684 TTTTATATAAAAATCTAGATTGG - Intergenic
1165546557 19:36541894-36541916 CTGTCAATAATAATATAAATGGG + Intronic
1165548250 19:36560939-36560961 ATGTAAATAAAAAGGTATTTAGG + Intronic
1166149066 19:40857843-40857865 CAGTAAATAAACTTGTATATAGG + Intronic
1167028161 19:46937360-46937382 CTTTCAATAAAAATGGGGATCGG - Exonic
1167960318 19:53099665-53099687 CTGCAATTAAAAATTTAAATGGG - Intronic
1168167614 19:54562236-54562258 CCATTAATAAAAATGCAGATTGG + Intergenic
925799738 2:7586261-7586283 CTGTAAAAAAAACTTTATATGGG - Intergenic
926585132 2:14677353-14677375 ATTTAAATAAAAAGGTAGATGGG - Intergenic
926855477 2:17251671-17251693 ATGTAAATATAAATATAAATGGG - Intergenic
926935469 2:18083409-18083431 CTATTAACAAAAATGTGGATTGG - Intronic
927405517 2:22762177-22762199 ATGTAAATAAAATAGTTGATTGG - Intergenic
927899382 2:26808286-26808308 CTGGAAATAAAAGTGCAGGTAGG - Intergenic
928011655 2:27613964-27613986 CTGTAAAAAAGATTTTAGATAGG + Intronic
928367430 2:30713612-30713634 CTCTAAAGAACAATGCAGATGGG - Intergenic
929550383 2:42886898-42886920 CTAAAAATAAAAATTTAGCTGGG + Intergenic
929765415 2:44839978-44840000 CTGTAAACAAAGATGTATTTGGG + Intergenic
929860123 2:45669708-45669730 GTGAAAATTAAAATGTATATCGG + Intronic
929921417 2:46174463-46174485 ATGTAAGTGAAAATGTAGATTGG + Intronic
930413236 2:51053939-51053961 CTGCAAATAAAAATGTGCAAAGG - Intergenic
930654776 2:53997070-53997092 CTGTAAATACAAACGAATATTGG - Intronic
930885264 2:56318630-56318652 CTGTTAATAAACATTTAAATTGG - Intronic
931381184 2:61754998-61755020 CTGAAAATAAAAAATTAGCTGGG - Intergenic
932636305 2:73391230-73391252 CTGTAGATAAATTTGGAGATGGG - Intronic
932910040 2:75796821-75796843 CTGTGAACAAAAATGAAGCTGGG + Intergenic
933049256 2:77581902-77581924 TTGTCTATAAAAATGTAGATTGG - Intronic
933389313 2:81650972-81650994 CAATTAATAAAAATATAGATTGG - Intergenic
933475090 2:82779410-82779432 TTATTAATAAAAATGTAGATTGG + Intergenic
933513504 2:83271095-83271117 CTGTAAATCAAAAAGTATCTGGG - Intergenic
933913470 2:86964674-86964696 CTGAAAATACAAAATTAGATGGG - Intronic
934009524 2:87805224-87805246 CTGAAAATACAAAATTAGATGGG + Intronic
934760486 2:96853196-96853218 GTGTAAATTAAAATGTACAGTGG - Intronic
935048531 2:99503459-99503481 CAATTAATAAAAGTGTAGATTGG + Intergenic
935468918 2:103433300-103433322 CTGTCAAGAAAAATGTGGGTAGG - Intergenic
935499635 2:103822301-103822323 CAGTAAAAAAAAATATAGAATGG + Intergenic
935934443 2:108166597-108166619 CTGCAAATAAAAATATAAGTAGG - Intergenic
936238124 2:110763298-110763320 CAGTAATTAAAAATGTATAGTGG + Intronic
936377214 2:111951776-111951798 CTGTTGATGAAAATGTAAATTGG - Intronic
936980405 2:118259430-118259452 CTGTATATAGAAATGTAACTTGG + Intergenic
937081156 2:119140942-119140964 CTGTAAAGAAAACTGAAGCTAGG + Intergenic
937210919 2:120269954-120269976 ATGTAAATAAAACATTAGATTGG - Intronic
937560369 2:123216835-123216857 CTGTAGAGAAAAATGTAATTAGG + Intergenic
939240158 2:139547980-139548002 CTGTAAAAAAAAATTCAGAAGGG - Intergenic
940110738 2:150149962-150149984 ATGTAAATAAAAAAATAAATGGG + Intergenic
940185849 2:150984386-150984408 CTTTAAACAAAAATGTAGCCAGG - Intergenic
941257927 2:163257187-163257209 CTCTAAATATAAAGGTAAATAGG + Intergenic
941282529 2:163571151-163571173 CTGAAAATAAAATTGTAACTGGG + Intergenic
941617813 2:167741265-167741287 TTGTAAATATCAATGTAAATTGG + Intergenic
941748173 2:169109353-169109375 CTGTCTATAAAAATATAGAGAGG - Intergenic
942152309 2:173089165-173089187 TTTTAAATAAAAAGGTAGAAGGG - Intronic
942747525 2:179251991-179252013 GTGGAAATAAGAATGTTGATAGG - Intronic
943190741 2:184676886-184676908 CTAAAAATATAAATGTAAATAGG + Intronic
943242628 2:185405796-185405818 ATTTAACTAAAAATGTAAATTGG - Intergenic
943408210 2:187514895-187514917 CAGTTAATAAAAATGTAGATTGG + Intronic
943431915 2:187813827-187813849 TGGCAAATAAAAATGTAAATTGG - Intergenic
943662064 2:190569885-190569907 CTGTAAATAAAAATGGAATCTGG - Intergenic
943953084 2:194155827-194155849 CTATTAATAAGAATGTGGATTGG - Intergenic
944235454 2:197437825-197437847 CTGAAAATAAAAAATTAGCTGGG - Intergenic
944321743 2:198353114-198353136 AATTAACTAAAAATGTAGATTGG - Intronic
944510487 2:200460318-200460340 ATGTAATTAAAAATGTTGAGGGG - Intronic
945159973 2:206879739-206879761 CTGTTGGTAAAAATGTAGATTGG - Intergenic
945289849 2:208116288-208116310 CGGTTAATAAAAATGTAGATTGG + Intergenic
945483266 2:210366494-210366516 CAATTAATAAAAATGTAGATTGG - Intergenic
945607061 2:211947973-211947995 CTTTAAATAAAAAAGCATATTGG + Intronic
945720397 2:213411349-213411371 CCATTAATAAAAATGTAGATTGG + Intronic
946485265 2:220095224-220095246 CAGTAAACAAAAATGTATGTTGG + Intergenic
946570233 2:221016459-221016481 ATCTAAATAAAAATAGAGATAGG + Intergenic
947090563 2:226506506-226506528 CTGTAAACAAAAATCAATATTGG + Intergenic
947827292 2:233115026-233115048 CTGAAAATACAAAATTAGATAGG - Intronic
948410788 2:237758830-237758852 TTTTAAATAAAACTGTAGTTTGG - Intronic
948471135 2:238180280-238180302 CGGGAAATAAAAATATAGACAGG + Intronic
1168822568 20:785420-785442 CGATTAATAAAAATGTAGACTGG - Intergenic
1168824399 20:799785-799807 CAATTAATAAACATGTAGATTGG + Intergenic
1169245990 20:4025196-4025218 CTGTATATAGAATTCTAGATTGG - Intergenic
1169323807 20:4658294-4658316 CTGGATATAAAATTTTAGATTGG - Intergenic
1169362313 20:4961380-4961402 TTGTAATTAAAAAAATAGATAGG - Intronic
1169436852 20:5600525-5600547 CTGAAAATAAAAAATTAGCTGGG + Intronic
1170275942 20:14588320-14588342 ATGTAAATAAAAACATACATTGG - Intronic
1170281661 20:14655959-14655981 CTGGAAATAGAAATGAAGAAAGG + Intronic
1170346979 20:15398201-15398223 CAATAAATCAAAAAGTAGATAGG - Intronic
1170998273 20:21387143-21387165 CTGTCATTAAAAATGTATATGGG + Intronic
1171005426 20:21460885-21460907 CTGAAAATACAAAAGTAGCTGGG + Intergenic
1171172815 20:23030943-23030965 TTGAAAATAAAAATTTAAATGGG - Intergenic
1171545855 20:26000701-26000723 ATGTATATACAAATATAGATTGG + Intergenic
1173010816 20:39180175-39180197 CTGTAAATGAGAATGTAAATTGG + Intergenic
1173277735 20:41599077-41599099 CTGTAAACAAAAGTGTAGACTGG + Intronic
1173629741 20:44503223-44503245 CTGCAAAAAAATATGTAGCTGGG - Intronic
1173728888 20:45315124-45315146 ATGTAAATAAAAATCATGATAGG + Intronic
1174259337 20:49282370-49282392 CTCTAAATAAAAATGTAGATTGG - Intergenic
1174930274 20:54805785-54805807 CTTAAAATAAAAATGTATCTTGG - Intergenic
1175587462 20:60154160-60154182 CTGTAAATATATATGTATACAGG + Intergenic
1177338680 21:19768334-19768356 GTGAGAATAAAAATGTTGATGGG - Intergenic
1177652415 21:23974931-23974953 CTGAAAATAAAAAATTAGCTGGG + Intergenic
1177806228 21:25877458-25877480 CTAAAAATAAAAAAGTAGTTGGG + Intergenic
1177849585 21:26330620-26330642 CTGAAAATAAAAATTTAGCCAGG - Intergenic
1177996013 21:28098720-28098742 CTGAAAATACAAAAGTAGCTGGG - Intergenic
1178002423 21:28177176-28177198 CTCTAAATAAAACTGTTGGTAGG + Intergenic
1178388321 21:32175644-32175666 CTGAAAAAAAAAAAGTAGCTGGG + Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1179043160 21:37822797-37822819 CTTTTAATAAATATTTAGATTGG + Intronic
1179226086 21:39454673-39454695 CTGTCAATCAAAATGGAGAAAGG - Intronic
1179235607 21:39542820-39542842 TTTAAAATAAAAATGGAGATGGG + Intergenic
1179433341 21:41340939-41340961 CTGTATATAAAAATATACATAGG - Intronic
1179670774 21:42945993-42946015 CAGTTAATAAAAATGTAGATTGG - Intergenic
1180320080 22:11311756-11311778 CTGTAAGTTCAAAGGTAGATTGG + Intergenic
1180434743 22:15289501-15289523 GTGACAATAAAAACGTAGATTGG + Intergenic
1180516948 22:16153315-16153337 GTGACAATAAAAATGTAGATTGG + Intergenic
1181375966 22:22458294-22458316 CTGTAAATAAAAATGTAGATTGG + Intergenic
1181379414 22:22488634-22488656 CTATAAATACAAATCTTGATAGG - Exonic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1183934373 22:41253777-41253799 CTGTAAATAGACATTTATATTGG + Intronic
949610838 3:5701957-5701979 AAATTAATAAAAATGTAGATTGG - Intergenic
949726023 3:7045978-7046000 CTGTAGATAAAAATGCAAATTGG - Intronic
950594141 3:13964117-13964139 GTGAAAATAAAAAAGTAGATTGG - Intronic
950845981 3:16016628-16016650 CAATTAATAAAAATCTAGATTGG - Intergenic
951561576 3:23972272-23972294 CAGTAATTAAAAATGGACATTGG - Intronic
951690681 3:25392625-25392647 CTGTGAAAAAAAATATACATAGG - Intronic
952467476 3:33605369-33605391 ATTTAAATAAAAGTTTAGATAGG + Intronic
953091977 3:39737081-39737103 CTTTAAATAAAAAGATTGATAGG + Intergenic
953295520 3:41711594-41711616 CTGTACATAAAAATCTACAGAGG + Intronic
954090147 3:48277714-48277736 CTATTAATAAAAATGTAGCTTGG + Intronic
954586610 3:51742044-51742066 CTGTAAATAAAAATGTAGATTGG + Intergenic
956467265 3:69531537-69531559 ATGTAAATGAAACTGTACATGGG + Intronic
956890286 3:73606675-73606697 TTGTAAATATGAAGGTAGATGGG - Intronic
957314375 3:78558526-78558548 CTTAAAACAAAAATGTTGATGGG + Intergenic
957403261 3:79744295-79744317 CTGTATATAAATATGTATTTAGG + Intronic
957642488 3:82874627-82874649 CTCTAAATAAAAATGCAGTCTGG + Intergenic
957816325 3:85302586-85302608 GTGTAAATCAAAGTGTAGACTGG + Intronic
957954494 3:87167333-87167355 CTGTATATATACATATAGATAGG - Intergenic
957989068 3:87608151-87608173 CTGTAAATAAAAATGTAGATTGG - Intergenic
957999805 3:87736794-87736816 CAGTTAATAAAAATGTAAATTGG - Intergenic
958017964 3:87964670-87964692 GAGCAAAGAAAAATGTAGATGGG + Intergenic
958065784 3:88543786-88543808 CTAAAAATAAAAATTTAGTTGGG + Intergenic
958269118 3:91476576-91476598 TTCTAAATAAAAATATGGATTGG - Intergenic
958819925 3:98961848-98961870 CATTTAATAAAAATGTATATGGG + Intergenic
958901243 3:99888635-99888657 CAGTATATAAAATTGTTGATAGG - Intronic
959468829 3:106723441-106723463 CTCTAAATATAAATTTATATAGG - Intergenic
959783622 3:110266701-110266723 CTGTCAATGAAGATGTAGCTTGG - Intergenic
959840100 3:110965639-110965661 CTATTAATAAAAATGTAGACTGG - Intergenic
960341648 3:116481503-116481525 ATATAAATATAAATATAGATTGG - Intronic
960421224 3:117447846-117447868 CTGGAAATAGATATGTGGATTGG - Intergenic
960659766 3:120044647-120044669 GTATCAACAAAAATGTAGATTGG + Intronic
960707577 3:120495227-120495249 CTATAAACAAAAGTGTAGACTGG + Intergenic
960720202 3:120618056-120618078 CAATTCATAAAAATGTAGATTGG - Intergenic
961316999 3:126045425-126045447 CTATAATTAAAAATGAAAATGGG + Intronic
961855113 3:129862388-129862410 CTGTAAAGCAAAATGTTAATAGG + Intronic
961917062 3:130387301-130387323 ATGTTAATAAAATTTTAGATAGG - Intronic
962029910 3:131588953-131588975 CTTAAAATCAAAATGTATATAGG + Intronic
962492767 3:135910015-135910037 TAGTAAATAAAAATGTAGAATGG + Intergenic
963389795 3:144646423-144646445 CTGTCAGTCAAAATGTAAATTGG - Intergenic
963442212 3:145355031-145355053 CTATTAATAAAAATGTAGATTGG - Intergenic
963518738 3:146338719-146338741 CTATTAATAAGAATGTGGATTGG + Intergenic
963728770 3:148950330-148950352 CTCTAAGGAAAAATGTAAATAGG + Intergenic
963820319 3:149884582-149884604 AACTAAAAAAAAATGTAGATGGG - Intronic
964611884 3:158624065-158624087 CTATTAATAAACATGTAGCTTGG - Intergenic
964932910 3:162047757-162047779 CAGTTAATAAAAATGTAGATTGG - Intergenic
964947390 3:162242970-162242992 CAGCAAATAAAAATTTACATGGG + Intergenic
965080730 3:164027885-164027907 GTTTAAAAAAAACTGTAGATGGG + Intergenic
965323418 3:167273912-167273934 CTATTAATAAAAATGTAGATTGG + Intronic
966721029 3:183062982-183063004 CTTAAAAAAAAAATGTAAATAGG - Intronic
966799295 3:183748001-183748023 CCCTAATTAAAAATGAAGATCGG - Intronic
967375839 3:188800060-188800082 CTAAAAATAATAATGTATATGGG + Intronic
967457916 3:189711201-189711223 CTGAAAAGCAAATTGTAGATGGG - Intronic
967548531 3:190761844-190761866 CTGTTGATGAGAATGTAGATTGG - Intergenic
967630503 3:191739263-191739285 CTATTAATAAGAATGTTGATTGG - Intergenic
967670492 3:192228418-192228440 CGATATATAAAAATGTAAATAGG + Intronic
967774417 3:193371809-193371831 GAGTTAATAAAAATGGAGATTGG - Intronic
968183597 3:196615549-196615571 CTAAAAAAAAAAATGTAGGTCGG - Intergenic
968253337 3:197243750-197243772 CAATTAATAAAAATGTAGATTGG - Intronic
968270097 3:197396961-197396983 CTGTAATTAAAAATGGGGAAAGG + Intergenic
968825325 4:2891879-2891901 CTGAAAATTAAATTGTAGAAGGG + Intronic
969083753 4:4640311-4640333 CTATAAATAAAAATAAAAATGGG + Intergenic
970133710 4:12898685-12898707 ATGTAAATAAAAAAATATATTGG + Intergenic
970300401 4:14675412-14675434 TTGTAAATAAACATGGGGATGGG - Intergenic
970398425 4:15695041-15695063 CTATTAATAAAAATGTGGCTTGG - Intronic
970667029 4:18348487-18348509 CTGTTGATGAAAATGTAAATTGG - Intergenic
970833376 4:20369735-20369757 CTGTATATAAAAAGGTAGCAGGG + Intronic
971732149 4:30398339-30398361 CTGTAAATATGAATGTTGCTAGG - Intergenic
971780700 4:31030506-31030528 ATGTAAATAAAAGTGTAACTTGG - Intronic
971971381 4:33624877-33624899 TTGTACACAAAAAAGTAGATGGG + Intergenic
972037732 4:34547915-34547937 ATATAAATATAAATGTACATAGG + Intergenic
972583672 4:40417373-40417395 CAGGAAAAAAAAATGTAGAAAGG + Intergenic
972785142 4:42319551-42319573 CAATTAATAAAAATGTATATTGG + Intergenic
972853145 4:43074124-43074146 CTGTAAATAAAAATGTGAATTGG + Intergenic
973047822 4:45556374-45556396 CTGTATATAGAATTCTAGATTGG + Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974544390 4:63281452-63281474 CAGGAAATAAAAAAGTAAATAGG + Intergenic
974616966 4:64300645-64300667 CTGTTAATAAATATGATGATAGG - Intronic
974890883 4:67880948-67880970 TTGTAAATAAAAATGGACTTTGG - Intronic
975730575 4:77333766-77333788 CTATAAACAAAAATGTAGATTGG - Intronic
975911886 4:79276887-79276909 CAGTTAGTAAAAATGTAGATTGG + Intronic
975998441 4:80342539-80342561 CTGGAAATGAAATTCTAGATTGG - Intronic
976777922 4:88726784-88726806 ATGTACATAAAAATATAGTTTGG - Exonic
977043457 4:92041632-92041654 CAGTTAATAAAAATGTAAATTGG - Intergenic
977296400 4:95214309-95214331 CTGTTTATAAAAATGAAGCTAGG - Intronic
977329952 4:95624903-95624925 CTGTACATAAAAATATCAATAGG - Intergenic
977609101 4:99014490-99014512 CGATAAACAAAAATGTAGACTGG - Intronic
977663192 4:99614877-99614899 CTGTCAATACAAATGTAGAAAGG + Intronic
977710514 4:100119109-100119131 CAGTGAATAAAAATGCACATCGG - Intergenic
977863774 4:101999043-101999065 CTGAACATAAAAATCTAGTTTGG + Intronic
977972489 4:103228215-103228237 CAGTTAATAAAAATGTAGATTGG + Intergenic
978311325 4:107387452-107387474 CTGTAAATAAAAATGTGAATTGG + Intergenic
978314334 4:107418824-107418846 CAATTAATAAAAATGTAGATTGG + Intergenic
978407325 4:108394404-108394426 CTCTAGATAAAAATGCAGCTTGG + Intergenic
978685747 4:111440551-111440573 CTATAAATAAAAATATTTATGGG + Intergenic
980077344 4:128307661-128307683 GTGGAAATAGAAATGTACATTGG - Intergenic
980200412 4:129649989-129650011 TTGTAAAAGAAAATGTACATAGG - Intergenic
980438639 4:132813663-132813685 CAATTAATAAAAATGTAGGTTGG - Intergenic
980459643 4:133091313-133091335 CTGTAGATATATATGTAGAATGG - Intergenic
980504865 4:133705451-133705473 ATGAAAACAAAAATGTAGAAGGG - Intergenic
980522050 4:133948110-133948132 CTATTAATAAAAATGTGGATTGG - Intergenic
980555919 4:134404600-134404622 ATGTATATAAAAATATAGCTGGG - Intergenic
981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG + Intergenic
981213096 4:142131792-142131814 CTGAAAATACAAAATTAGATGGG + Intronic
981711316 4:147711301-147711323 CTGAAAATACAAAAGTAGTTGGG - Intergenic
982669202 4:158299762-158299784 CAGGAAATAAATATGTAGAGAGG - Intergenic
983081580 4:163391806-163391828 CTGTACACACAAATGTAGATAGG + Intergenic
984065765 4:175045737-175045759 CTGTACAAAAAAATTAAGATAGG - Intergenic
984159627 4:176235720-176235742 CTGTTAATGAGAATGTAAATAGG - Intronic
984529049 4:180893288-180893310 CTTTTAATAAAAATGTTGCTTGG + Intergenic
984897312 4:184553146-184553168 CTTTAAAAAAAAATTGAGATGGG + Intergenic
985901978 5:2803649-2803671 CTGTAACTCAAAATGTATTTTGG - Intergenic
987204216 5:15608612-15608634 CTGAAAATAATAATATGGATGGG + Intronic
988192210 5:27953132-27953154 CTATAAATAAAAATGAACTTTGG - Intergenic
988715936 5:33828372-33828394 CTGGAAATAAATAAGAAGATGGG - Intronic
989059631 5:37397503-37397525 CTGCAAATAATAATGATGATGGG + Intronic
989095939 5:37781305-37781327 CAGTTAATAAAAATGTTAATTGG - Intergenic
989197814 5:38732972-38732994 CTTTAAATAAAAAGATAAATTGG + Intergenic
989316643 5:40088236-40088258 ATGTAAACAAAAATGTATGTTGG - Intergenic
989613370 5:43316281-43316303 CAATTAATAAAAATGCAGATTGG - Intergenic
990452499 5:55949128-55949150 CTGTACAGTAAAATGTAGAGAGG - Intronic
991216383 5:64160952-64160974 CTATTAATAAAAATGTAGATTGG + Intergenic
991224521 5:64254608-64254630 CTATTAATAAAAATATAGATAGG + Intronic
991306187 5:65178399-65178421 CAGTTAATAAAAATGTAGATTGG + Intronic
992665580 5:79005513-79005535 CATTAAATAAAAATACAGATCGG + Intronic
993381241 5:87211065-87211087 ATGAAAAAAAAAATGTAGTTGGG + Intergenic
993432354 5:87847425-87847447 CTTTAAAAAAAAATGTAGCTTGG - Intergenic
993663672 5:90668839-90668861 TAGTAAATAAAAATATAGTTAGG + Intronic
994337703 5:98588071-98588093 CTGATAATAAAAATGAATATTGG + Intergenic
994629641 5:102268555-102268577 CCCTAATTAAAAATATAGATAGG - Intronic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
994780683 5:104086255-104086277 ATCTCAAAAAAAATGTAGATTGG - Intergenic
995405114 5:111785951-111785973 CTGGAAAGAAAAATGAAGAGAGG + Intronic
995654245 5:114406931-114406953 CTGGATATAAAACTCTAGATTGG + Intronic
995792983 5:115913481-115913503 TTTTAAATAAAAATGTAAAAAGG + Exonic
996194849 5:120591823-120591845 TTGTAAATAAAAATGCAGAAGGG + Intronic
996275246 5:121658659-121658681 ATGAAAATAGAAATGTAAATTGG + Intergenic
996655401 5:125928082-125928104 TTATTAATAAAAATGTGGATTGG + Intergenic
996847302 5:127913983-127914005 ATGTGAATAAAAATGGAGAGGGG + Intergenic
997014052 5:129909863-129909885 CTGTAGTTAACAATATAGATGGG + Intronic
997064104 5:130542760-130542782 CTATTAATAAAAATGTGGATTGG - Intergenic
998484986 5:142494089-142494111 ATGTTAATGAAAATGCAGATGGG + Intergenic
998552333 5:143089700-143089722 AAATTAATAAAAATGTAGATTGG - Intronic
998938466 5:147255805-147255827 CAATTAATAAAAATGTAGATTGG - Intronic
999033871 5:148325362-148325384 ATGTAAATGAAAATGTAAAATGG - Intronic
999353665 5:150903789-150903811 CTGTATACAAAAATGGTGATAGG + Intronic
999554381 5:152723977-152723999 CTATAAACAAAAATGTAAATTGG + Intergenic
999785333 5:154885058-154885080 CTGCAAACAAAAATGTAGACTGG + Intergenic
1000236930 5:159370639-159370661 CAGTTAATAAAAATGTAAATTGG + Intergenic
1000427283 5:161106643-161106665 CTGAAAGTAAAGATTTAGATTGG + Intergenic
1000451105 5:161387981-161388003 AAGTAAAAAAAAATGTAGGTTGG + Intronic
1000513343 5:162210126-162210148 CTGTAAATAAACATATATACAGG + Intergenic
1000950400 5:167474911-167474933 CAGTAAATAAAAATGAAGAAAGG - Intronic
1001208697 5:169789850-169789872 CTATAAATAAAAATGGAAATGGG - Intronic
1001558326 5:172651725-172651747 CAGTTAATAAAAATGTAGATTGG - Intronic
1002999004 6:2313620-2313642 CACTTAATAAAAATGTAAATTGG - Intergenic
1004696488 6:18038689-18038711 CTTCAAATAAATATGTAGGTTGG + Intergenic
1005458694 6:26046612-26046634 CTGTAAATATAAATTTATAATGG + Intergenic
1005462047 6:26078516-26078538 CAGTTAATAAAAATGTAGATTGG + Intergenic
1005575480 6:27185549-27185571 CTATTAACAAAAATGTAGACTGG + Intergenic
1006049400 6:31329944-31329966 CTATCAATAAAAATGTAGACTGG - Intronic
1006325665 6:33351914-33351936 CAATTAATAAAAGTGTAGATTGG - Intergenic
1007328058 6:41078411-41078433 ATATAAACAAAAATGTAGATAGG - Intronic
1007899624 6:45399006-45399028 CTGTAAATAAATTTCTAGTTAGG + Intronic
1008123580 6:47644945-47644967 CAGTTAATAAAAATGTAGATTGG + Intergenic
1008182658 6:48352018-48352040 CAGTAAATAAAAATTTAGATTGG + Intergenic
1008599062 6:53071711-53071733 GTGTACATGAAAATGTAAATTGG + Intronic
1009569915 6:65371393-65371415 CTGTATATAACATTTTAGATTGG + Intronic
1009589071 6:65642890-65642912 CTTTGATTAAAAATGTAGATAGG + Intronic
1009628118 6:66162724-66162746 CAATAAATAAAAATGTAGATTGG - Intergenic
1009635918 6:66263756-66263778 CAATTAATAAAAATGTAGATTGG + Intergenic
1009892232 6:69700007-69700029 CTGTGAAGAAAAAGGTAGTTAGG - Intronic
1010417601 6:75630797-75630819 CTAGAAATAATAATGTAGAAAGG - Intronic
1010454202 6:76036067-76036089 CTTTACATAAATAAGTAGATGGG - Intronic
1010853672 6:80810704-80810726 CTGTATGTAAATAGGTAGATTGG + Intergenic
1010884920 6:81224483-81224505 TTGTAAATAAACATGTGGAATGG - Intergenic
1011035763 6:82972671-82972693 ATGTACATAAAAATATAGCTTGG + Intronic
1011211827 6:84963947-84963969 CTATTACTAAAAATGTAGCTTGG - Intergenic
1011570525 6:88729553-88729575 CAATTAATAAAAATGTAGATTGG + Intronic
1012146146 6:95685286-95685308 GTGTACATAAAAATGTAGTCTGG + Intergenic
1012311544 6:97731047-97731069 AAGTAAATAAAAATGTATAAAGG + Intergenic
1012470196 6:99564089-99564111 CTGTTAATACAAATGGAAATTGG - Intronic
1012939051 6:105398512-105398534 CAGTAAATAAAAAGGAAGAAAGG - Intronic
1012948343 6:105491577-105491599 CTGGAAATAAAAATGTCCAGTGG - Intergenic
1012962159 6:105633616-105633638 CTGTTGATAAGAATGTAAATTGG + Intergenic
1013217591 6:108042359-108042381 CTGCAAATAAAAATGTACTTTGG - Exonic
1013993688 6:116282225-116282247 GTGTAAATAAAAAGGAATATTGG + Intronic
1014197623 6:118577531-118577553 CTATAAAGAAAAATGTAAACTGG + Intronic
1014244588 6:119054147-119054169 CTGTAAAAAATAGTGGAGATGGG - Intronic
1014505057 6:122244974-122244996 CTGTAAACATAAATGTAAATGGG + Intergenic
1015273565 6:131361586-131361608 CTTTACAGCAAAATGTAGATCGG + Intergenic
1015297194 6:131609331-131609353 CTGGAAATAAAAATATAAAGGGG - Intronic
1015989308 6:138919751-138919773 CTGTGAATAAAAATAAAGCTGGG - Intronic
1016088352 6:139944066-139944088 GTGTAATTAAAAATGTTGAATGG + Intergenic
1016659784 6:146564771-146564793 TTGTAGTTAAAAATGTAGAGTGG - Intergenic
1017160199 6:151358799-151358821 CTGTACATAAAACTTTATATTGG - Intergenic
1017260653 6:152382977-152382999 CTCTAAAGCAAAATGTATATGGG - Intronic
1017339186 6:153300763-153300785 CTGTAAATAACAATAAAGTTTGG - Intergenic
1017700916 6:157070315-157070337 CTTTGAATAAAAATCTATATTGG + Intronic
1018191218 6:161310740-161310762 CAATTAATAAAAATGTAGATTGG - Intergenic
1019023193 6:168936276-168936298 CTGTAGATGAAAATGAAGAGAGG + Intergenic
1019694226 7:2435973-2435995 CTGAAAATAAAAAACTAGCTGGG - Intergenic
1020745563 7:12074308-12074330 CTATCAATAAAAACATAGATTGG + Intergenic
1021075158 7:16294462-16294484 CTGTAAAAAAAAAAGTAAATTGG - Intronic
1021160365 7:17265022-17265044 CTGTTAATAGGAATGTAAATTGG - Intergenic
1021738050 7:23658199-23658221 GTATTAATAAAAATGTAGCTTGG + Intergenic
1022361813 7:29667368-29667390 CTAAAAATAAAAAAGTAGCTGGG - Intergenic
1022699578 7:32746357-32746379 CTAAAAATAAAAAAGTAGCTGGG + Intergenic
1023313993 7:38916398-38916420 CTGGAAAAAAAAATGCAAATTGG - Intronic
1023334146 7:39150767-39150789 CTGTTGATAGAAATGTAGATTGG - Intronic
1023436181 7:40142926-40142948 CAATTAATAAAAATGTAGATTGG - Intronic
1023799222 7:43818932-43818954 CAATTAATAAAAATGTAGATTGG + Intergenic
1023799664 7:43822847-43822869 GTGACCATAAAAATGTAGATTGG + Intergenic
1023960633 7:44923118-44923140 CTGTTAATAAATATGTGGGTAGG - Intergenic
1024494804 7:50033415-50033437 CTGTAAAGAACCATGTAGACAGG - Intronic
1024652776 7:51420377-51420399 CTGTTAATGAGAATGTAAATTGG - Intergenic
1024712319 7:52029948-52029970 CATTAAATATAAATGTTGATGGG - Intergenic
1024813052 7:53235835-53235857 CAGTTAATAAAAATGTAGATTGG + Intergenic
1024848287 7:53677031-53677053 CTGTTCATGGAAATGTAGATTGG - Intergenic
1025037952 7:55611025-55611047 CTGTTAATGAGAATGTAAATTGG - Intergenic
1027445433 7:78268029-78268051 ACGTAAATATACATGTAGATAGG + Intronic
1027598205 7:80202858-80202880 CTGTAAATCAGTATGGAGATGGG - Intronic
1027883468 7:83872961-83872983 CTGGAAATAAAATTTGAGATGGG - Intergenic
1027931276 7:84538039-84538061 CTGAAAATGAAAATGTAAAGAGG - Intergenic
1028334134 7:89629889-89629911 GTGACAATAAAAATGTAGATTGG + Intergenic
1030155671 7:106451929-106451951 CTTTTAATAAAAATGGAGACCGG - Intergenic
1030720443 7:112864604-112864626 CTGTAAATATGAGTGTAGAGTGG - Intronic
1031018661 7:116602948-116602970 TTGTTAATTAAAATGTGGATTGG - Intergenic
1031416957 7:121506722-121506744 CTATAAACAAAAGTGTAAATTGG - Intergenic
1031844077 7:126783135-126783157 CTGTAAATAAAAATGATGACTGG - Intronic
1032098501 7:128952905-128952927 TTTTAAATTAAAATCTAGATGGG + Intergenic
1032158713 7:129492953-129492975 GTGTAAAAAAAAATGTTGGTAGG - Intergenic
1032170659 7:129582000-129582022 CAGTTAATAAAAATGTAGATTGG + Intergenic
1032182635 7:129693653-129693675 CAGTAAAGAAAAGTTTAGATCGG - Intronic
1032643937 7:133800075-133800097 CTGTAAGTATAAATGTAGAGAGG - Intronic
1032958422 7:137001062-137001084 CTGTGCTTTAAAATGTAGATTGG - Intronic
1033024523 7:137759640-137759662 CTATCAATAAGAATGTAGAAGGG - Intronic
1033034652 7:137862970-137862992 ATGTCAATAAAAATGTAATTGGG - Intergenic
1033096897 7:138440216-138440238 CAATTAATAAAAATGTAGATTGG - Intergenic
1033894194 7:146052116-146052138 CTATTAATAAAAATGTGGATTGG - Intergenic
1033969941 7:147026207-147026229 GTGTATATAAAATTGAAGATAGG + Intronic
1034220349 7:149440014-149440036 ATTTACATAAATATGTAGATGGG + Intronic
1034539636 7:151748644-151748666 CTGAAAATTAAAATGTAAAGGGG + Intronic
1034643032 7:152620095-152620117 CTGAAAATAAAAAATTAGCTGGG + Intergenic
1035150928 7:156872484-156872506 CTAAAAATAAAAATTTAGCTGGG + Intronic
1036104260 8:5823524-5823546 CAGTTAATAAAAATGTAGATTGG - Intergenic
1036674709 8:10820886-10820908 CTCTAAATAAAAAGCTACATAGG + Intronic
1037435607 8:18860028-18860050 CTTTAAATAAAATTCTAGAAAGG - Intronic
1038089770 8:24240083-24240105 CAGTTAATAAAAATGTAGATTGG + Intergenic
1038657330 8:29465761-29465783 CTGTAAATATAGATGAAGCTTGG - Intergenic
1039705645 8:40004390-40004412 ATGTAGATAAATAGGTAGATAGG + Intronic
1040531995 8:48273820-48273842 CTGAAAAAAAAAATGCAGTTGGG + Intergenic
1040983321 8:53267914-53267936 CTATAAACAAGAATGTAGATTGG - Intergenic
1041077579 8:54183266-54183288 CTATAAATAAAAAAGCAGCTGGG - Intergenic
1041812537 8:61927646-61927668 CTCAAAATAAAAATGTAGGATGG - Intergenic
1042074434 8:64975008-64975030 CAATAAATATAAATGTAAATTGG - Intergenic
1042087734 8:65127317-65127339 CAATGAATAAAAATGTAGATTGG - Intergenic
1042146635 8:65736588-65736610 CTAAAAATAAAAATGTAGTCTGG + Intronic
1042393220 8:68260205-68260227 TTTTAAATAAAAATGTTTATTGG + Intergenic
1042931877 8:74022244-74022266 CTAAAAATACAAAAGTAGATGGG + Intronic
1043371395 8:79597876-79597898 CTGTTAATGGGAATGTAGATTGG + Intergenic
1043724003 8:83585944-83585966 CTCTAAATAAAACTTTATATTGG + Intergenic
1044200912 8:89435006-89435028 CTGTAAACAAAGATGTCGAAAGG + Intergenic
1044896869 8:96901863-96901885 AAGTAAATAAAAATGTTAATTGG - Intronic
1045084700 8:98670065-98670087 CTGTATATAAAAATGAATAGAGG + Intronic
1045133832 8:99190304-99190326 CTTTAAATAATAAAGTAGATAGG - Intronic
1045271258 8:100663667-100663689 CTGTAAATAAGAATGTGGCTGGG + Intergenic
1046256183 8:111699202-111699224 TTGTAAATAAAATTGTTGTTTGG + Intergenic
1046295384 8:112212858-112212880 ATGTAAAAAAAAAAATAGATTGG + Intergenic
1046970371 8:120216453-120216475 TTGTATATAACAATGCAGATGGG + Exonic
1047177505 8:122555465-122555487 CTGTAAATACAAAGGGAGATTGG - Intergenic
1047603001 8:126445909-126445931 CAGGAAAAAAAAATGTAGATCGG - Intergenic
1047738264 8:127785392-127785414 CAGGAAATACTAATGTAGATGGG + Intergenic
1048184194 8:132224315-132224337 CTGTAATTAAAAATCTAAACAGG + Intronic
1048675909 8:136779891-136779913 CTGAAAATAAAAAATTAGCTGGG - Intergenic
1048709758 8:137195962-137195984 CAGCAAATAAAAATGTAGGATGG - Intergenic
1048821696 8:138386053-138386075 CTAAAAATAAAAAAGTAGCTGGG + Intronic
1049071754 8:140360896-140360918 CTGGAAAAAAAAAAGTAGTTGGG - Intronic
1050197139 9:3097427-3097449 CTGGAAATATAATTGTAGTTAGG - Intergenic
1050343524 9:4663664-4663686 CTGTAAATATACATGCAGACAGG + Exonic
1050481015 9:6086746-6086768 CTGTAAATAAAAATGTGAATTGG + Intergenic
1050532344 9:6601416-6601438 CTGTATATAAAAGTGAAGACTGG + Intronic
1050718722 9:8560896-8560918 GTGTAAATAAAGATGCAGAAAGG + Intronic
1050941443 9:11464277-11464299 CTGTTAATGGAAATGTAAATTGG - Intergenic
1050970526 9:11866644-11866666 GTGAAAATAAAAATGCTGATGGG + Intergenic
1051064397 9:13084957-13084979 CTTTAAATAAAAAGCTAGACAGG + Intergenic
1051200495 9:14615697-14615719 CTGCAAACAAAAATGTTTATGGG - Exonic
1051246012 9:15111873-15111895 ATGTAAATGAAGATGCAGATGGG + Intergenic
1051493023 9:17688333-17688355 CGGTGAAAAAAAATGTAGTTTGG + Intronic
1051814048 9:21083592-21083614 CTGTTAGTAAGAATGTAAATTGG - Intergenic
1052508196 9:29381666-29381688 CAGTTAATTAAAATGTAGATTGG + Intergenic
1052617826 9:30865198-30865220 CTGTATTTAAAAATGTATATGGG - Intergenic
1052872462 9:33521481-33521503 TTTTAAATAAAAATGGATATAGG + Intergenic
1052962296 9:34309207-34309229 CAGTACATAAAAATCTAAATTGG - Intronic
1053642104 9:40093766-40093788 CGGGAAAGGAAAATGTAGATTGG + Intergenic
1053705387 9:40747987-40748009 GTGACAATAAAAATGTAGATTGG - Intergenic
1053764033 9:41371691-41371713 CGGGAAAGGAAAATGTAGATTGG - Intergenic
1054322997 9:63691155-63691177 CGGGAAAGGAAAATGTAGATTGG + Intergenic
1054415463 9:64871594-64871616 GTGACAATAAAAATGTAGATTGG - Intergenic
1054542647 9:66282881-66282903 CGGGAAAGGAAAATGTAGATTGG - Intergenic
1054858504 9:69926393-69926415 CTATTAATAAAAATGTAAATTGG - Intergenic
1054953136 9:70876024-70876046 CTCCAAATAAAAAGGTAGAAGGG + Intronic
1055225889 9:73994777-73994799 CTGCAAATAAAAATCAAGATTGG - Intergenic
1056083393 9:83120712-83120734 CTTAAAATAAAAATGTAGATTGG + Intergenic
1056414308 9:86361657-86361679 CAATTAATAAAAATGTAGATTGG - Intergenic
1056806157 9:89730605-89730627 CTGCAAATAAAAATATACCTGGG - Intergenic
1057685153 9:97226478-97226500 TTTTAAATAAAAATGGATATAGG - Intergenic
1058327852 9:103720577-103720599 TTGTTAATTAAAATTTAGATTGG + Intergenic
1058861460 9:109120955-109120977 TTTTAAATCAAAATGTTGATTGG - Intergenic
1059702050 9:116784766-116784788 CTGAAAATACAAAAGTAGACAGG + Intronic
1059968858 9:119643685-119643707 CTGTAAATATAAATGCCTATGGG + Intergenic
1060379092 9:123148683-123148705 CTGTAAATAAAATTTTGAATAGG - Intronic
1060635633 9:125197758-125197780 CTGTAAATAAATAAATAAATAGG + Intergenic
1061739248 9:132687825-132687847 CTGGAAATAAGATTGTAGAGTGG + Intronic
1061786673 9:133033111-133033133 CTATAAATAAAAATGTAGATTGG - Intronic
1061829136 9:133279636-133279658 CTATAAACAAAAATGTAGACTGG - Intergenic
1062456725 9:136643445-136643467 CTGTAAATCCAAAGGTAGAAGGG + Intergenic
1185654818 X:1676451-1676473 ATGTAAACACACATGTAGATAGG - Intergenic
1185933727 X:4232239-4232261 CTGTACATAAAGATGAAGAATGG - Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186468270 X:9801526-9801548 CTGTAAATTAAAATATACACTGG + Intronic
1187065043 X:15825834-15825856 TTGAAAATAAATGTGTAGATAGG + Exonic
1187770277 X:22687932-22687954 CTGTTAATGGGAATGTAGATTGG - Intergenic
1188047475 X:25443421-25443443 ATGTTAATAAAAATCTAGTTTGG - Intergenic
1188076233 X:25778679-25778701 CTGTAAAGAGAAATATAAATTGG + Intergenic
1188927500 X:36062992-36063014 ATGTTAATGAAAATGTAAATGGG - Intronic
1189034717 X:37483707-37483729 CAATTAATAAAAATGTAGATTGG + Intronic
1189085591 X:38019794-38019816 CTATAAATAAAAAGTTAGTTGGG - Intronic
1189780570 X:44510486-44510508 CTGTTGGTAGAAATGTAGATTGG - Intergenic
1189833703 X:45000238-45000260 CAATTAATAAAAATGTAGATTGG - Intronic
1190021356 X:46880217-46880239 GTGTACATAAAAATGTGCATAGG - Exonic
1190089169 X:47422468-47422490 CTATAAATAAAAATGGACAAAGG + Intergenic
1190191886 X:48283699-48283721 CTGAAAATAAAAAATTAGACAGG - Intergenic
1190270378 X:48858568-48858590 CAGTTAATAAAAATTTAGATTGG + Intergenic
1190822988 X:53991828-53991850 CTTTAAAAAAAAATAGAGATGGG - Intronic
1191169332 X:57425050-57425072 CTGAAAATAAAAAATTAGAAAGG + Intronic
1191917865 X:66221778-66221800 CAGTTAATAAAAATGTAAATTGG - Intronic
1192132506 X:68565947-68565969 CTGAAAATAAAAAAATATATGGG - Intergenic
1192681461 X:73258047-73258069 CTGTAAATAAAAATGTGGATTGG - Intergenic
1192906217 X:75554034-75554056 TTGTTGATAAAAATGTAAATTGG - Intergenic
1192915360 X:75645904-75645926 CAGTTAATAGAAATGTAGATTGG - Intergenic
1193599464 X:83491864-83491886 CTGTAAAGCACAATGTAGATAGG + Intergenic
1193717438 X:84949233-84949255 CAGTTAATAAAAATATAGACTGG + Intergenic
1194557709 X:95382114-95382136 CTGTATATAAAAATGTTCATTGG + Intergenic
1195012778 X:100749759-100749781 CTGTTAATGGAAATGTAAATTGG - Intergenic
1195755884 X:108198434-108198456 ATGTAAAAAAAAATGTAAAAAGG + Intronic
1195806125 X:108768365-108768387 CAGCAAAGAAAAATGTACATTGG - Intergenic
1195815811 X:108886031-108886053 CTGTAAAAAAAAATTGAGACTGG - Intergenic
1195846697 X:109237008-109237030 CAATTAATAAAAATGTAGATTGG - Intergenic
1196069463 X:111504181-111504203 CTTTAAAAAAAAATCTAGTTTGG - Intergenic
1196220111 X:113103875-113103897 CTGTACATAAATTTGTAGAAAGG - Intergenic
1196377986 X:115055862-115055884 CAAGAGATAAAAATGTAGATAGG - Intergenic
1196459973 X:115919659-115919681 CAGTTAATAAAAATGTAAATTGG - Intergenic
1196739684 X:119013729-119013751 ATGTAAATATAAATGAATATAGG - Intronic
1198742591 X:139856730-139856752 CAGTTAATAAAAATGTAGATTGG + Intronic
1198764674 X:140068387-140068409 GTCTAAAAAAAAAAGTAGATTGG + Intergenic
1199638461 X:149836016-149836038 CAATTAATAAAAATGTAGATTGG + Intergenic
1200769394 Y:7109487-7109509 CAATTAATAAAAATATAGATTGG + Intergenic
1200802605 Y:7400066-7400088 CTATGAATAAAAATGTAGACTGG + Intergenic
1201259981 Y:12149418-12149440 CAGTTAATGAAAATGTAGATTGG - Intergenic
1201309019 Y:12577679-12577701 CCATTAATAAAATTGTAGATTGG + Intergenic
1201350711 Y:13037956-13037978 CTCTAAATAATAATGTTGCTGGG + Intergenic
1201940276 Y:19451398-19451420 CTCTAAACAAAAATGTAGATTGG + Intergenic
1201972203 Y:19810466-19810488 CTGTAAATAAAAATGTGAATTGG - Intergenic
1202087324 Y:21152646-21152668 TTATAAACAAAAATGAAGATCGG - Intergenic
1202590180 Y:26474248-26474270 CTAGAAATAAAAATTTAGCTGGG + Intergenic