ID: 1130495731

View in Genome Browser
Species Human (GRCh38)
Location 15:84468740-84468762
Sequence GGCCCCCTGCAGGGCCCGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130495731_1130495739 1 Left 1130495731 15:84468740-84468762 CCCACCGGGCCCTGCAGGGGGCC No data
Right 1130495739 15:84468764-84468786 TGGAGAAGCTGCAGGTGAGTAGG No data
1130495731_1130495740 7 Left 1130495731 15:84468740-84468762 CCCACCGGGCCCTGCAGGGGGCC No data
Right 1130495740 15:84468770-84468792 AGCTGCAGGTGAGTAGGTCCTGG No data
1130495731_1130495741 12 Left 1130495731 15:84468740-84468762 CCCACCGGGCCCTGCAGGGGGCC No data
Right 1130495741 15:84468775-84468797 CAGGTGAGTAGGTCCTGGCATGG No data
1130495731_1130495743 22 Left 1130495731 15:84468740-84468762 CCCACCGGGCCCTGCAGGGGGCC No data
Right 1130495743 15:84468785-84468807 GGTCCTGGCATGGGCCAACAAGG No data
1130495731_1130495747 25 Left 1130495731 15:84468740-84468762 CCCACCGGGCCCTGCAGGGGGCC No data
Right 1130495747 15:84468788-84468810 CCTGGCATGGGCCAACAAGGGGG No data
1130495731_1130495744 23 Left 1130495731 15:84468740-84468762 CCCACCGGGCCCTGCAGGGGGCC No data
Right 1130495744 15:84468786-84468808 GTCCTGGCATGGGCCAACAAGGG No data
1130495731_1130495750 30 Left 1130495731 15:84468740-84468762 CCCACCGGGCCCTGCAGGGGGCC No data
Right 1130495750 15:84468793-84468815 CATGGGCCAACAAGGGGGGCGGG No data
1130495731_1130495742 13 Left 1130495731 15:84468740-84468762 CCCACCGGGCCCTGCAGGGGGCC No data
Right 1130495742 15:84468776-84468798 AGGTGAGTAGGTCCTGGCATGGG No data
1130495731_1130495745 24 Left 1130495731 15:84468740-84468762 CCCACCGGGCCCTGCAGGGGGCC No data
Right 1130495745 15:84468787-84468809 TCCTGGCATGGGCCAACAAGGGG No data
1130495731_1130495749 29 Left 1130495731 15:84468740-84468762 CCCACCGGGCCCTGCAGGGGGCC No data
Right 1130495749 15:84468792-84468814 GCATGGGCCAACAAGGGGGGCGG No data
1130495731_1130495737 -7 Left 1130495731 15:84468740-84468762 CCCACCGGGCCCTGCAGGGGGCC No data
Right 1130495737 15:84468756-84468778 GGGGGCCATGGAGAAGCTGCAGG No data
1130495731_1130495748 26 Left 1130495731 15:84468740-84468762 CCCACCGGGCCCTGCAGGGGGCC No data
Right 1130495748 15:84468789-84468811 CTGGCATGGGCCAACAAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130495731 Original CRISPR GGCCCCCTGCAGGGCCCGGT GGG (reversed) Intergenic
No off target data available for this crispr