ID: 1130500173

View in Genome Browser
Species Human (GRCh38)
Location 15:84491416-84491438
Sequence CATTATATTTAGAAATTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130500173_1130500175 5 Left 1130500173 15:84491416-84491438 CCATTTAATTTCTAAATATAATG No data
Right 1130500175 15:84491444-84491466 GAGGAAAAGAGAAAATAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130500173 Original CRISPR CATTATATTTAGAAATTAAA TGG (reversed) Intergenic
No off target data available for this crispr