ID: 1130501275

View in Genome Browser
Species Human (GRCh38)
Location 15:84500959-84500981
Sequence CAGGGGGCGCGCGGGTTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130501275_1130501286 1 Left 1130501275 15:84500959-84500981 CCCCTCAACCCGCGCGCCCCCTG No data
Right 1130501286 15:84500983-84501005 GCACCCGTTTCGGCGGCTGCAGG No data
1130501275_1130501290 27 Left 1130501275 15:84500959-84500981 CCCCTCAACCCGCGCGCCCCCTG No data
Right 1130501290 15:84501009-84501031 CCAGAGCATGCGCGCGCTTCCGG No data
1130501275_1130501280 -9 Left 1130501275 15:84500959-84500981 CCCCTCAACCCGCGCGCCCCCTG No data
Right 1130501280 15:84500973-84500995 CGCCCCCTGCGCACCCGTTTCGG No data
1130501275_1130501283 -6 Left 1130501275 15:84500959-84500981 CCCCTCAACCCGCGCGCCCCCTG No data
Right 1130501283 15:84500976-84500998 CCCCTGCGCACCCGTTTCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130501275 Original CRISPR CAGGGGGCGCGCGGGTTGAG GGG (reversed) Intergenic