ID: 1130503604

View in Genome Browser
Species Human (GRCh38)
Location 15:84516496-84516518
Sequence CTGCCCTTGCCAATCACCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130503604_1130503617 29 Left 1130503604 15:84516496-84516518 CCTGGGGTGATTGGCAAGGGCAG No data
Right 1130503617 15:84516548-84516570 CTGACTGACTAGGCTTTGGTTGG No data
1130503604_1130503618 30 Left 1130503604 15:84516496-84516518 CCTGGGGTGATTGGCAAGGGCAG No data
Right 1130503618 15:84516549-84516571 TGACTGACTAGGCTTTGGTTGGG No data
1130503604_1130503613 5 Left 1130503604 15:84516496-84516518 CCTGGGGTGATTGGCAAGGGCAG No data
Right 1130503613 15:84516524-84516546 GGGCTGCTTGCTGAAGGGGTGGG No data
1130503604_1130503609 -1 Left 1130503604 15:84516496-84516518 CCTGGGGTGATTGGCAAGGGCAG No data
Right 1130503609 15:84516518-84516540 GGGACTGGGCTGCTTGCTGAAGG No data
1130503604_1130503611 1 Left 1130503604 15:84516496-84516518 CCTGGGGTGATTGGCAAGGGCAG No data
Right 1130503611 15:84516520-84516542 GACTGGGCTGCTTGCTGAAGGGG No data
1130503604_1130503615 19 Left 1130503604 15:84516496-84516518 CCTGGGGTGATTGGCAAGGGCAG No data
Right 1130503615 15:84516538-84516560 AGGGGTGGGGCTGACTGACTAGG No data
1130503604_1130503614 6 Left 1130503604 15:84516496-84516518 CCTGGGGTGATTGGCAAGGGCAG No data
Right 1130503614 15:84516525-84516547 GGCTGCTTGCTGAAGGGGTGGGG No data
1130503604_1130503616 25 Left 1130503604 15:84516496-84516518 CCTGGGGTGATTGGCAAGGGCAG No data
Right 1130503616 15:84516544-84516566 GGGGCTGACTGACTAGGCTTTGG No data
1130503604_1130503612 4 Left 1130503604 15:84516496-84516518 CCTGGGGTGATTGGCAAGGGCAG No data
Right 1130503612 15:84516523-84516545 TGGGCTGCTTGCTGAAGGGGTGG No data
1130503604_1130503610 0 Left 1130503604 15:84516496-84516518 CCTGGGGTGATTGGCAAGGGCAG No data
Right 1130503610 15:84516519-84516541 GGACTGGGCTGCTTGCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130503604 Original CRISPR CTGCCCTTGCCAATCACCCC AGG (reversed) Intergenic
No off target data available for this crispr