ID: 1130510001

View in Genome Browser
Species Human (GRCh38)
Location 15:84581636-84581658
Sequence CTGTGCAATTTTAATAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130509995_1130510001 4 Left 1130509995 15:84581609-84581631 CCATCCATTAGGAAAGTGGCCCT No data
Right 1130510001 15:84581636-84581658 CTGTGCAATTTTAATAGAGTGGG No data
1130509997_1130510001 0 Left 1130509997 15:84581613-84581635 CCATTAGGAAAGTGGCCCTTGGT No data
Right 1130510001 15:84581636-84581658 CTGTGCAATTTTAATAGAGTGGG No data
1130509992_1130510001 14 Left 1130509992 15:84581599-84581621 CCAAGAAGACCCATCCATTAGGA No data
Right 1130510001 15:84581636-84581658 CTGTGCAATTTTAATAGAGTGGG No data
1130509994_1130510001 5 Left 1130509994 15:84581608-84581630 CCCATCCATTAGGAAAGTGGCCC No data
Right 1130510001 15:84581636-84581658 CTGTGCAATTTTAATAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130510001 Original CRISPR CTGTGCAATTTTAATAGAGT GGG Intergenic
No off target data available for this crispr