ID: 1130511674

View in Genome Browser
Species Human (GRCh38)
Location 15:84594818-84594840
Sequence AGGGAGAATGCAGCAACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130511666_1130511674 26 Left 1130511666 15:84594769-84594791 CCCTCAGCAGTGGCCGCTGTGGT No data
Right 1130511674 15:84594818-84594840 AGGGAGAATGCAGCAACTGTGGG No data
1130511667_1130511674 25 Left 1130511667 15:84594770-84594792 CCTCAGCAGTGGCCGCTGTGGTG No data
Right 1130511674 15:84594818-84594840 AGGGAGAATGCAGCAACTGTGGG No data
1130511664_1130511674 30 Left 1130511664 15:84594765-84594787 CCATCCCTCAGCAGTGGCCGCTG No data
Right 1130511674 15:84594818-84594840 AGGGAGAATGCAGCAACTGTGGG No data
1130511668_1130511674 13 Left 1130511668 15:84594782-84594804 CCGCTGTGGTGCTGAGAGAATCT No data
Right 1130511674 15:84594818-84594840 AGGGAGAATGCAGCAACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130511674 Original CRISPR AGGGAGAATGCAGCAACTGT GGG Intergenic
No off target data available for this crispr