ID: 1130517790

View in Genome Browser
Species Human (GRCh38)
Location 15:84639524-84639546
Sequence GCCCAAAGTGAACTCCCACG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 60}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130517783_1130517790 27 Left 1130517783 15:84639474-84639496 CCATTACATCTCCCTTTTGTCTG 0: 1
1: 0
2: 1
3: 55
4: 618
Right 1130517790 15:84639524-84639546 GCCCAAAGTGAACTCCCACGTGG 0: 1
1: 0
2: 3
3: 6
4: 60
1130517784_1130517790 16 Left 1130517784 15:84639485-84639507 CCCTTTTGTCTGCCTGCAAACAG 0: 1
1: 0
2: 2
3: 20
4: 228
Right 1130517790 15:84639524-84639546 GCCCAAAGTGAACTCCCACGTGG 0: 1
1: 0
2: 3
3: 6
4: 60
1130517785_1130517790 15 Left 1130517785 15:84639486-84639508 CCTTTTGTCTGCCTGCAAACAGA 0: 1
1: 0
2: 1
3: 13
4: 229
Right 1130517790 15:84639524-84639546 GCCCAAAGTGAACTCCCACGTGG 0: 1
1: 0
2: 3
3: 6
4: 60
1130517786_1130517790 4 Left 1130517786 15:84639497-84639519 CCTGCAAACAGATTTTCCAATCC 0: 1
1: 0
2: 3
3: 15
4: 183
Right 1130517790 15:84639524-84639546 GCCCAAAGTGAACTCCCACGTGG 0: 1
1: 0
2: 3
3: 6
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130517790 Original CRISPR GCCCAAAGTGAACTCCCACG TGG Exonic