ID: 1130520649

View in Genome Browser
Species Human (GRCh38)
Location 15:84658368-84658390
Sequence CCACACTCTGGCCCGCACGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 221}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130520638_1130520649 7 Left 1130520638 15:84658338-84658360 CCCCTTTGGGCCGCCCAGAGACC 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1130520649 15:84658368-84658390 CCACACTCTGGCCCGCACGCGGG 0: 1
1: 0
2: 0
3: 6
4: 221
1130520639_1130520649 6 Left 1130520639 15:84658339-84658361 CCCTTTGGGCCGCCCAGAGACCT 0: 1
1: 0
2: 0
3: 9
4: 152
Right 1130520649 15:84658368-84658390 CCACACTCTGGCCCGCACGCGGG 0: 1
1: 0
2: 0
3: 6
4: 221
1130520634_1130520649 21 Left 1130520634 15:84658324-84658346 CCAGGCAGGGGCACCCCCTTTGG 0: 1
1: 0
2: 2
3: 17
4: 188
Right 1130520649 15:84658368-84658390 CCACACTCTGGCCCGCACGCGGG 0: 1
1: 0
2: 0
3: 6
4: 221
1130520641_1130520649 -3 Left 1130520641 15:84658348-84658370 CCGCCCAGAGACCTGCACACCCA 0: 1
1: 1
2: 5
3: 42
4: 437
Right 1130520649 15:84658368-84658390 CCACACTCTGGCCCGCACGCGGG 0: 1
1: 0
2: 0
3: 6
4: 221
1130520637_1130520649 8 Left 1130520637 15:84658337-84658359 CCCCCTTTGGGCCGCCCAGAGAC 0: 1
1: 0
2: 0
3: 8
4: 84
Right 1130520649 15:84658368-84658390 CCACACTCTGGCCCGCACGCGGG 0: 1
1: 0
2: 0
3: 6
4: 221
1130520642_1130520649 -6 Left 1130520642 15:84658351-84658373 CCCAGAGACCTGCACACCCACAC 0: 1
1: 0
2: 6
3: 41
4: 503
Right 1130520649 15:84658368-84658390 CCACACTCTGGCCCGCACGCGGG 0: 1
1: 0
2: 0
3: 6
4: 221
1130520643_1130520649 -7 Left 1130520643 15:84658352-84658374 CCAGAGACCTGCACACCCACACT 0: 1
1: 0
2: 2
3: 24
4: 354
Right 1130520649 15:84658368-84658390 CCACACTCTGGCCCGCACGCGGG 0: 1
1: 0
2: 0
3: 6
4: 221
1130520640_1130520649 5 Left 1130520640 15:84658340-84658362 CCTTTGGGCCGCCCAGAGACCTG 0: 1
1: 0
2: 1
3: 10
4: 148
Right 1130520649 15:84658368-84658390 CCACACTCTGGCCCGCACGCGGG 0: 1
1: 0
2: 0
3: 6
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130520649 Original CRISPR CCACACTCTGGCCCGCACGC GGG Exonic