ID: 1130525929

View in Genome Browser
Species Human (GRCh38)
Location 15:84706245-84706267
Sequence GGAACCATTATGTCCCTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 112}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130525929_1130525933 17 Left 1130525929 15:84706245-84706267 CCATTAAGGGACATAATGGTTCC 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1130525933 15:84706285-84706307 GACTGCTACTTGGTCACTTCGGG 0: 1
1: 0
2: 2
3: 20
4: 151
1130525929_1130525932 16 Left 1130525929 15:84706245-84706267 CCATTAAGGGACATAATGGTTCC 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1130525932 15:84706284-84706306 AGACTGCTACTTGGTCACTTCGG 0: 1
1: 0
2: 9
3: 62
4: 451
1130525929_1130525931 7 Left 1130525929 15:84706245-84706267 CCATTAAGGGACATAATGGTTCC 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1130525931 15:84706275-84706297 TGAATGTTAAGACTGCTACTTGG 0: 1
1: 0
2: 2
3: 20
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130525929 Original CRISPR GGAACCATTATGTCCCTTAA TGG (reversed) Intronic
909126245 1:71673574-71673596 GGAAACATTATTTCTCTTAAGGG + Intronic
917031490 1:170697303-170697325 GGAACAATGATCTCCCTTGAAGG + Intronic
917889813 1:179425051-179425073 GGAACCATGATCTCCCCAAATGG - Intronic
918110753 1:181453466-181453488 GGGACCATTAACTCCCTTGAAGG - Intronic
919488201 1:198170541-198170563 GGAACCTTTTTATTCCTTAAAGG + Intronic
919964465 1:202508259-202508281 TGAACATTTATGTACCTTAAAGG - Intronic
1070671492 10:78380572-78380594 GGATGCATTATGGCCCTGAAAGG + Intergenic
1074515266 10:114161782-114161804 GGAACCCAGATGTCCATTAATGG + Intronic
1075249028 10:120849302-120849324 GAAACCTTTATATCCCTTACAGG + Intergenic
1076271529 10:129156427-129156449 GGAATCATTATGTCCCCTGGTGG - Intergenic
1076315146 10:129534549-129534571 GGTGCATTTATGTCCCTTAAAGG - Intronic
1079854138 11:25579374-25579396 GAAACTATTATATCTCTTAAGGG - Intergenic
1083968113 11:66055342-66055364 GGACTCATTAGGTCCCTGAAGGG + Intronic
1084198058 11:67537156-67537178 GGGTCCATTATGTCCCTTGGTGG - Intergenic
1086370114 11:86147957-86147979 AGAACCAACATGTCCCTTTAAGG + Intergenic
1087318387 11:96631491-96631513 GGAGACATTATGCCCCTTATGGG + Intergenic
1089008262 11:115111275-115111297 GGAACCATTCTGTCTCCTGAAGG + Intergenic
1091071828 11:132572173-132572195 GCAACCATTATGTCCAGTAAGGG - Intronic
1092263397 12:6963914-6963936 GGGCCCATTGTGTCCCTTAGTGG - Intergenic
1095634864 12:44421250-44421272 GGAACCATTGTGTTCCTGCAAGG - Intergenic
1099816980 12:87661887-87661909 GGAACCCTTATTTAACTTAATGG - Intergenic
1101633720 12:106520105-106520127 AGAATCATTCTGTACCTTAAAGG + Intronic
1104496509 12:129245454-129245476 GCAACCAAGATGTCCCTTAATGG - Intronic
1111981529 13:95021107-95021129 GGATCCATTATTTCCCCTGAAGG - Exonic
1115425430 14:33253642-33253664 TCACCCATTATGTTCCTTAATGG + Intronic
1119261825 14:73242245-73242267 GGAAACAGCATGTCCCTTAGGGG + Intronic
1123692525 15:22850450-22850472 GGAACGATAATGCACCTTAATGG + Intronic
1127498143 15:59531535-59531557 GGGAGCCTTAAGTCCCTTAATGG + Intergenic
1128101156 15:65001057-65001079 GGAAGCATTGTGTCCCTCACGGG - Intergenic
1129785306 15:78306267-78306289 GGAACAATTATGTCCCTGTGGGG - Intergenic
1130194578 15:81767418-81767440 GCAACCATGATGTCCTTTACAGG + Intergenic
1130525929 15:84706245-84706267 GGAACCATTATGTCCCTTAATGG - Intronic
1138474504 16:57262926-57262948 GGAACGATTATGGCCCTGGATGG - Intronic
1138746795 16:59372485-59372507 GGAAACATTATGTCCTTCAATGG - Intergenic
1139189880 16:64849964-64849986 GCAACCAAGATGTCCTTTAATGG + Intergenic
1140802845 16:78505047-78505069 GGAACAATAATATCCCTTAGAGG - Intronic
1145218993 17:21073210-21073232 GGTACCATCCTGCCCCTTAAAGG + Intergenic
1156009472 18:32479892-32479914 GGAACTATCTTGTCCCTTCAAGG - Intergenic
1156109399 18:33706068-33706090 GGAATTATTATGTCACTCAATGG - Intronic
1158038509 18:53064758-53064780 TGATCCATTATTTCCTTTAAAGG + Intronic
1159319209 18:66824824-66824846 GGAATAATTATCTCCCTAAAAGG - Intergenic
1162210972 19:9091798-9091820 GGAGCCACTATGTCCATGAATGG - Intergenic
1164562303 19:29300608-29300630 GGAACCATTCTGGCCATTCAGGG + Intergenic
1166797690 19:45437457-45437479 TTATCCATTATGTCCCTTGATGG - Intronic
926470985 2:13257673-13257695 GGAAGCAATATGTCCGTTAGTGG - Intergenic
930573280 2:53113353-53113375 GGAACATTTATGGACCTTAAAGG + Intergenic
931107596 2:59073495-59073517 TGAACCCTTATTTGCCTTAAGGG - Intergenic
931328094 2:61249257-61249279 GGAACCTTTATTTTACTTAATGG - Intronic
932855295 2:75227447-75227469 GGGACAATTTTGTCCCTTAGGGG + Intergenic
932921957 2:75926450-75926472 GGAACCTTTATGTTTCTTTAGGG - Intergenic
938798989 2:134742725-134742747 GTAACCCAAATGTCCCTTAAAGG + Intergenic
940020648 2:149152978-149153000 GGAAGCACTAAGTCCCCTAATGG + Intronic
945543796 2:211123569-211123591 GGAACCAGAGTGTCCCTTAGCGG - Intergenic
945635494 2:212344383-212344405 GGAGCAATTATGTGCCTTAGGGG - Intronic
947614883 2:231549506-231549528 GGCCCCATTTTGTCCCTTAGTGG + Intergenic
948350121 2:237333418-237333440 GAAACTATTAGGTCCATTAATGG - Intronic
1175668264 20:60878850-60878872 GGAAGCATCATTTACCTTAATGG - Intergenic
1176795865 21:13371025-13371047 AGAAGCCTTTTGTCCCTTAAGGG + Intergenic
1178676656 21:34636928-34636950 GGCACCATTATAAGCCTTAAGGG - Intergenic
1180289546 22:10784256-10784278 AGAAGCCTTTTGTCCCTTAAGGG + Intergenic
1180305350 22:11068543-11068565 AGAAGCCTTTTGTCCCTTAAGGG - Intergenic
1183736875 22:39649237-39649259 GGGCCCATCATGTGCCTTAAGGG + Intronic
1184701309 22:46175282-46175304 GGAAACATTATGTATCTTGATGG - Intronic
1184756139 22:46516993-46517015 GGAACCTTTATCACCCATAAGGG + Intronic
950974479 3:17226271-17226293 GGAACCAGTATGTAGCTTATGGG - Intronic
956690508 3:71873978-71874000 GCAACCAAGATGTCCTTTAATGG + Intergenic
957244637 3:77701950-77701972 GGAAACATTCAGTCCCTTTAGGG - Intergenic
964028195 3:152103745-152103767 GCAACCAAGATGTTCCTTAAAGG - Intergenic
968220010 3:196930263-196930285 AGACCCATCATGGCCCTTAATGG - Intronic
969473780 4:7409089-7409111 GGAACCATGATCTCCCAAAATGG - Intronic
971042381 4:22768220-22768242 GGAGCCATTATGTGCATTAATGG - Intergenic
971992721 4:33920825-33920847 GCAACCAATATGTCCTTTAGAGG - Intergenic
976771982 4:88663179-88663201 GGAACCATTATGTACGTTTCTGG - Intronic
980620338 4:135293557-135293579 GGAACCATGATGTCCACAAATGG - Intergenic
983874406 4:172859521-172859543 GGCAGCATTATTTCCCTTTAAGG - Intronic
986723296 5:10575905-10575927 GGAACCTTTTTGTGCCTTGATGG + Intronic
989508258 5:42253519-42253541 GGAACAGTTATTTTCCTTAAAGG - Intergenic
993664705 5:90681677-90681699 AGCTCCATTATGTTCCTTAAAGG - Intronic
997367869 5:133337225-133337247 GCAATCATGATGTCCCTCAATGG - Intronic
997800199 5:136853246-136853268 GGAGACAGTCTGTCCCTTAATGG + Intergenic
1001309935 5:170603404-170603426 GGAACCAGTAAATCCGTTAATGG - Intronic
1002724253 5:181283887-181283909 AGAAGCCTTTTGTCCCTTAAGGG - Intergenic
1003836695 6:10079030-10079052 GGAACCAATTTGTTCCTTCATGG - Intronic
1007221893 6:40285333-40285355 GGAACCATAGTCTCCATTAAAGG - Intergenic
1009639274 6:66309611-66309633 GAAACCTTTGTTTCCCTTAAAGG - Intergenic
1010086916 6:71931102-71931124 GAAAGCATTAAGTTCCTTAAGGG - Intronic
1022162100 7:27721423-27721445 GGAATCAAGATGTCCGTTAAAGG + Intergenic
1022382706 7:29875269-29875291 GGGCCCATTGTGTCTCTTAAGGG - Intronic
1022786287 7:33640815-33640837 CGAAACATCATTTCCCTTAAAGG - Intergenic
1023574870 7:41616464-41616486 AGAACCATTAAGTCTATTAATGG - Intergenic
1028046368 7:86125498-86125520 GGATACATTATTTCCTTTAATGG - Intergenic
1028149184 7:87352325-87352347 GGATCCATCATGTCCCTTGGTGG + Intronic
1028998305 7:97126293-97126315 GGAAGCAGTCTGTCCCTTAGTGG + Intronic
1029035653 7:97518407-97518429 TGAATCATTATGTCCATTGAGGG - Intergenic
1030946246 7:115725125-115725147 AGAGCCATTATGACCCTTACAGG - Intergenic
1035137246 7:156716108-156716130 TGAAACTTTATGTTCCTTAAAGG - Intronic
1038110381 8:24490492-24490514 GGAAGCAGTATGACCCTTCAAGG + Intronic
1038538705 8:28373457-28373479 GGAAGCATGATGTTCTTTAAAGG - Intronic
1041900576 8:62978208-62978230 GGAAGCAGTCTGTCCCTTAGCGG + Exonic
1042551529 8:69998121-69998143 GGAAGCATTCTGTCCTTTCAGGG - Intergenic
1042815185 8:72870537-72870559 GGAAACAGTGTGTCCCATAATGG + Intronic
1044708210 8:95028923-95028945 GGAACCATTTTGTTCCCCAAAGG + Intronic
1045078174 8:98593817-98593839 GGAACCATTCTGTCTCTTCAAGG - Intronic
1047293470 8:123550677-123550699 GAAAATATTATGTCCCTTAAGGG - Intergenic
1047890684 8:129304703-129304725 AGAACCAGTATGTCCCTTTCTGG + Intergenic
1051052956 9:12952807-12952829 GAAACCTTTATATCCCTTTATGG + Intergenic
1051144699 9:14014498-14014520 TGAACCAATATGACCCTGAAAGG + Intergenic
1051545358 9:18268296-18268318 GGAACCAATATGCCCCAAAAGGG - Intergenic
1052139439 9:24960882-24960904 GCAACCATCATGTCCTTTAGTGG + Intergenic
1053886390 9:42647320-42647342 AGAAGCCTTTTGTCCCTTAAGGG - Intergenic
1055038981 9:71848348-71848370 GAAACCATTATATCCTATAAAGG - Intergenic
1060532158 9:124354245-124354267 GGACCCACTGTGTCCCTGAAAGG - Intronic
1186150266 X:6667310-6667332 GGAAGCAGTTTGTGCCTTAAGGG + Intergenic
1186241789 X:7576053-7576075 GGACTCATTATGTACCTTCAGGG - Intergenic
1188808653 X:34623617-34623639 TGAAACATTATGTCCCTATAAGG + Intergenic
1191153099 X:57242103-57242125 GGAAGCAGTCTGTCCCTTAGTGG - Intergenic
1196264695 X:113628591-113628613 GGCACCTCTAAGTCCCTTAAAGG - Intergenic
1198128429 X:133670444-133670466 GGAACCATTCTGATACTTAAGGG - Intronic
1202300098 Y:23404118-23404140 TGAACATTTATGTACCTTAAAGG - Intergenic
1202570712 Y:26266480-26266502 TGAACATTTATGTACCTTAAAGG + Intergenic