ID: 1130531108

View in Genome Browser
Species Human (GRCh38)
Location 15:84748483-84748505
Sequence GGCTGCCGCGGCGGGGGATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 177}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130531108_1130531120 3 Left 1130531108 15:84748483-84748505 CCCAATCCCCCGCCGCGGCAGCC 0: 1
1: 0
2: 1
3: 11
4: 177
Right 1130531120 15:84748509-84748531 GCCAGGTCCCGCCGCCAGGCCGG 0: 1
1: 1
2: 4
3: 19
4: 215
1130531108_1130531118 -1 Left 1130531108 15:84748483-84748505 CCCAATCCCCCGCCGCGGCAGCC 0: 1
1: 0
2: 1
3: 11
4: 177
Right 1130531118 15:84748505-84748527 CCCAGCCAGGTCCCGCCGCCAGG 0: 1
1: 0
2: 2
3: 26
4: 270
1130531108_1130531127 27 Left 1130531108 15:84748483-84748505 CCCAATCCCCCGCCGCGGCAGCC 0: 1
1: 0
2: 1
3: 11
4: 177
Right 1130531127 15:84748533-84748555 TCCCGCCCCCGCTCCGCCCCCGG 0: 1
1: 0
2: 6
3: 98
4: 736

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130531108 Original CRISPR GGCTGCCGCGGCGGGGGATT GGG (reversed) Intergenic
900244210 1:1630146-1630168 GGCTGGCGGGGTGGGTGATTTGG - Intronic
900245234 1:1633405-1633427 GGCTGCCGCGGTCGGGCTTTGGG + Intronic
900256465 1:1700564-1700586 GGCTGCCGCGGTCGGGCTTTGGG + Intronic
900512967 1:3069041-3069063 CGCCGCCTCGGCGCGGGATTGGG - Intergenic
900589926 1:3454934-3454956 GGCTGCCGGGGCGGGGCTTGCGG - Intronic
903072198 1:20732045-20732067 GGCTGCGGCGGCGGGAGACGCGG - Intronic
903627923 1:24744918-24744940 GGGTGCTGCAGCGGGGGAGTGGG + Intergenic
904045284 1:27604645-27604667 GGCTGCTGGGGCGGGGGAGCGGG + Intergenic
904384333 1:30131676-30131698 GGCTGCTGCAGGGCGGGATTAGG + Intergenic
905212700 1:36385637-36385659 GGCGGCCGCGGCGGTGGAATCGG - Intronic
910092122 1:83478140-83478162 GGCTGTGGAGGCGGGGGATGAGG - Intergenic
914474542 1:148012496-148012518 GGCTGCGGGGGTGGGGGAGTGGG - Intergenic
914889759 1:151612259-151612281 GGCGGCGGCGGCGGGGGGTCTGG + Exonic
917345178 1:174022142-174022164 GGCTGCCGCGGCGGTGGCGACGG - Exonic
921060380 1:211579449-211579471 GGGTGCAGCGGCGGGCGAATTGG + Intergenic
922648791 1:227318708-227318730 GGCTGCCGCAGCGTGGAATGCGG + Intergenic
922950969 1:229558420-229558442 GGCTGCCGGGGCGGGGGTCCGGG - Exonic
1066464213 10:35639472-35639494 GGCGGCGGCGGCGGGGGACCCGG - Exonic
1070610050 10:77926734-77926756 GGCTGCCGCGGCGGCGGGACTGG + Intergenic
1072107746 10:92290739-92290761 GGCTCCAGCGCCGGGGGCTTCGG + Intronic
1073503935 10:103967392-103967414 GACTCCCGCGGCGGCGGCTTAGG - Exonic
1074065358 10:110008207-110008229 GGCGGCCGCAGCGGCGGATCCGG + Exonic
1077010265 11:376499-376521 GGCTGCTGGGGCGGGGGACTGGG - Exonic
1077253958 11:1572421-1572443 GGCTGCCGCGGGGGGGGGGCGGG + Intergenic
1077514210 11:2992064-2992086 GGCGGCCGCGGCGGGGCCTGGGG - Intronic
1078144250 11:8712370-8712392 GGCTGCAGCGGGGGTGGGTTTGG - Intronic
1078599686 11:12719147-12719169 GGCTGCGGAGGAGGGGGCTTGGG - Intronic
1078679529 11:13462964-13462986 GGCTGCTGCGGCGGTGGTCTGGG - Intronic
1079122545 11:17695995-17696017 CGGTGCCGGGGCGAGGGATTAGG + Intergenic
1079251705 11:18791892-18791914 GGCTGGCGGGGCGGGGGACCGGG + Intronic
1084284168 11:68120948-68120970 GGCTGCGGCGGCGGGGGCTGGGG + Exonic
1087634544 11:100687592-100687614 GGCGGCCGCGGCGGGCGCTGGGG - Intergenic
1091173301 11:133537743-133537765 TGCTCCCGCGGAGTGGGATTTGG - Intergenic
1091498363 12:991502-991524 GGCTGCCGAGGAGGGGGAGGGGG - Intronic
1091720891 12:2812693-2812715 GGCTGTCGCGACGGGGGTTCAGG + Exonic
1092861891 12:12725626-12725648 GGCTGGGGCCGCGGGAGATTCGG - Intergenic
1096598696 12:52714470-52714492 GGCCGCAGCGGCTGGGGCTTGGG - Intergenic
1096668145 12:53180747-53180769 GGCAGCCGCGGCGGTGGGGTTGG + Exonic
1102421678 12:112808338-112808360 AGCTGCCGCGGCTGGGGCTGAGG - Intronic
1103402102 12:120650145-120650167 GGCAGCTGCGGCTGGGAATTAGG - Intronic
1104444711 12:128823859-128823881 GGCGGCCGCGGCGGCGGCTGGGG - Exonic
1104912801 12:132247771-132247793 GGCTGCAGCGTCCGGGGATGGGG - Intronic
1108541685 13:51452326-51452348 GGCGGCCGGGGCGGGGGTGTCGG - Intronic
1116919822 14:50560721-50560743 GGCTCCCGGGGAGGGGGGTTGGG - Intronic
1119649912 14:76376247-76376269 GGCGGCCGCGGCGGGGGAGAGGG - Intronic
1122270761 14:100567676-100567698 GGCCGCTGCGGCGGGGGCTGGGG - Intronic
1122486597 14:102086599-102086621 GGGGACCGCGGCGGGGGACTGGG - Intronic
1123039956 14:105486444-105486466 GGCTGCGGGGGCTGGGGTTTCGG - Intergenic
1123735595 15:23180052-23180074 TGCTGCCGGGGCGGGGGTCTGGG + Intergenic
1124286311 15:28403035-28403057 TGCTGCCGGGGCGGGGGTCTGGG + Intergenic
1124296392 15:28508601-28508623 TGCTGCCGGGGCGGGGGTCTGGG - Intergenic
1126034961 15:44537206-44537228 GGCGGCGGCGGCGGGGGACTCGG + Exonic
1126210108 15:46092339-46092361 GGCTGAGGCGGCGGGGGGGTGGG + Intergenic
1126852403 15:52805386-52805408 GGCGGCGGCGGCGGGGGGTTGGG + Intergenic
1127144107 15:56007279-56007301 TGCTGCGGCGGCGGGGGAGGCGG + Intergenic
1127144115 15:56007297-56007319 GGCGGCGGCGGCGGGGGAGGCGG + Intergenic
1127144123 15:56007315-56007337 GGCGGCGGCGGCGGGGGAGGCGG + Intergenic
1127144131 15:56007333-56007355 GGCGGCGGCGGCGGGGGAGGCGG + Intergenic
1127144139 15:56007351-56007373 GGCGGCGGCGGCGGGGGAGGCGG + Intergenic
1127144147 15:56007369-56007391 GGCGGCGGCGGCGGGGGAGGCGG + Intergenic
1128521116 15:68375493-68375515 GGCTGCCCTGGCTGGGGGTTGGG + Intronic
1130531108 15:84748483-84748505 GGCTGCCGCGGCGGGGGATTGGG - Intergenic
1132099541 15:99014219-99014241 GGCTGCGGCGGAGGCGGTTTTGG - Intergenic
1132851563 16:2027127-2027149 GGCGGCCTCGGCGGGGGAACCGG - Exonic
1133051604 16:3120277-3120299 GGCGGCGGCGGCGGGGGCTCTGG + Exonic
1134208945 16:12259921-12259943 GGCAGAGGCAGCGGGGGATTAGG - Intronic
1135735822 16:24931146-24931168 GGCTGCGGCGGTGGGTGATTGGG + Exonic
1137926717 16:52547317-52547339 GGCGGCCGCGGCGGGGGTGATGG - Intronic
1138247629 16:55479286-55479308 GGCGGCGGCGGCGGGGGCTGGGG + Exonic
1138328065 16:56191741-56191763 GGCGGCGGCGGCGCGGGATGTGG - Intronic
1139576914 16:67847469-67847491 GCCTGCCGCAGCCGGGGCTTGGG + Intronic
1140723090 16:77788617-77788639 GGCTGCGGCGCTGGGGGAGTGGG - Exonic
1141831167 16:86510615-86510637 GGCGGCGGCGGCGGGGGAGGCGG + Exonic
1146034093 17:29390831-29390853 GGCGGCGGCGGCGGGGGGTGGGG - Exonic
1146332342 17:31937426-31937448 GGCGGCAGCGGCGGGGGCTGCGG + Exonic
1147184248 17:38705185-38705207 GGCTGCCGCGGCCGGGCAGGGGG + Intergenic
1147643139 17:42017389-42017411 GGCTGCCGCGGAGTGCGATGTGG - Exonic
1147988594 17:44320227-44320249 GGCTGCTGCTGCGGAGGATCCGG - Exonic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1149500557 17:57149212-57149234 AGCTGCCGGGGCAGGGGCTTTGG + Intergenic
1150060581 17:62065365-62065387 GGCGGCGGCGGCGGGGGGGTGGG - Intergenic
1150060677 17:62065686-62065708 CGCTGCCGCGCCGGGGGCCTGGG - Intergenic
1150108739 17:62479492-62479514 GGCGGCCCCGGCCTGGGATTGGG + Intronic
1151750287 17:76033290-76033312 GGCTGCAGGGGCTGGGGAGTGGG - Intergenic
1151971655 17:77460532-77460554 GGCTGGCGTGGCTGGGGTTTGGG + Intronic
1154303908 18:13217498-13217520 GGCCGCCGTGGCGGGGGCTCAGG - Intronic
1155519939 18:26657211-26657233 GCCCGCCGCGGCGGGCGACTAGG - Intronic
1156266932 18:35497762-35497784 GGCAGCAGCGGCGGGGGCTATGG - Exonic
1157496798 18:48162084-48162106 GCCTGCGGCGGCGGGGGGTCTGG - Intronic
1160499719 18:79395751-79395773 GGCTGCCGCGGCGCGGGGAGGGG + Intergenic
1160868821 19:1267867-1267889 GGCTGCCGCTGACGGGGAGTGGG + Intronic
1161087863 19:2343459-2343481 GGCCGCCTCAGCGGGGGCTTTGG - Intronic
1161395642 19:4043665-4043687 GGCAGCCCCGGCGAGGGATGGGG + Intergenic
1161471107 19:4457271-4457293 CGATGCAGTGGCGGGGGATTAGG - Intronic
1162363121 19:10231265-10231287 GGCGGCCGCGGCTGGGGCTGGGG + Exonic
1162830740 19:13282678-13282700 GGATGCCTGGGCGGGGGGTTGGG + Intronic
1162934160 19:13972873-13972895 GGCGGCGGCGGCGGGGGAGGCGG - Exonic
1163463833 19:17455085-17455107 GGGTGCCCCGGCGGAGGGTTGGG - Intronic
1163607097 19:18281488-18281510 GGCCGGCGCGGCGGGGGAGGCGG - Exonic
1165493916 19:36141045-36141067 GGCGGCGGCGGCGGGGGAGGCGG + Exonic
1165770109 19:38375031-38375053 GGCTTCCGCGGCCCGGGACTTGG - Intronic
1165914150 19:39247716-39247738 GGCGGCCGCGGGGAGGGATGTGG - Intergenic
1167473256 19:49686833-49686855 GGCAGCCGGGGTGGGGGATGGGG + Intronic
1168401682 19:56088984-56089006 GGCGGCCGCGGCCGGGGAGGCGG + Exonic
925386969 2:3468667-3468689 GGCTGCCCCGCCGTGGGAGTGGG - Intronic
927181101 2:20447289-20447311 GGCTGCCGCGGCGGGGGCGGTGG - Exonic
927703084 2:25280324-25280346 GGCTGCCGGGGTGGGGGGTGGGG - Intronic
927932138 2:27051984-27052006 GGCTCCCGCGGCAGGGGATTAGG - Intronic
928964832 2:36966355-36966377 GGCTGCCGCGGCCGGCGACGGGG - Exonic
929815004 2:45223624-45223646 TGCTGTGGCGGCGGGGGGTTGGG - Intergenic
935971535 2:108534477-108534499 GGCCGCGGCGGCGAGGGACTAGG + Intronic
938271856 2:129979679-129979701 GGCTGCGGCGGCGGCGGCTGGGG + Exonic
938444145 2:131364121-131364143 GGCTGCGGCGGCGGCGGCTGGGG - Intergenic
940035742 2:149310572-149310594 GGCTGCGGCGGCCGGGGACTTGG - Intergenic
946019812 2:216633401-216633423 GGCTGCGGCGGCGAGGGAGGAGG + Exonic
947353640 2:229271340-229271362 GGCGGCGGCGGCGGGGGAGGAGG - Intergenic
948456925 2:238108929-238108951 CGCTGCCGGGAGGGGGGATTGGG - Intronic
948770247 2:240248106-240248128 CGCTGCCGGGGCTGGGGGTTGGG + Intergenic
1169265998 20:4167754-4167776 GGCTGCCACGGTGGGAGAATCGG - Intronic
1170564997 20:17594686-17594708 GGCTGCAGAGGAGGGAGATTAGG - Intronic
1171185706 20:23122658-23122680 GGATTCCACGGCGGGGGCTTGGG + Intergenic
1171223492 20:23421399-23421421 GGCGGCCGCGGCGGGCGACATGG - Exonic
1172117985 20:32583319-32583341 GGCGGCCGCGGAGGGGGAGGGGG + Intronic
1174611659 20:51802279-51802301 GGCGCCCGCGGCGGGGGAGCTGG - Exonic
1176172067 20:63700570-63700592 GGCTGCACCTGCGGGGGCTTTGG - Intronic
1176576575 21:8443306-8443328 GGCGGCGGCGGCGGGGGTGTGGG + Intergenic
1178257218 21:31065153-31065175 GTCTGCCGGGGCGGGGGTTGGGG + Intergenic
1178552739 21:33555102-33555124 GGCTGCGGCGGCTGGGGGTGCGG - Exonic
1178552746 21:33555123-33555145 GGCTGCGGCGGCTGGGGGTGCGG - Exonic
1178552753 21:33555144-33555166 GGCTGCGGCGGCTGGGGGTGCGG - Exonic
1181478243 22:23181365-23181387 GGCAGCCGCGTCGGGGGAACGGG + Exonic
1183989743 22:41589871-41589893 TGCTGACGGGGCGGGGCATTAGG + Exonic
1185418014 22:50720585-50720607 GGCGGCCGCGGCCGGCGCTTGGG - Intergenic
1203254625 22_KI270733v1_random:132364-132386 GGCGGCGGCGGCGGGGGTGTGGG + Intergenic
1203262681 22_KI270733v1_random:177443-177465 GGCGGCGGCGGCGGGGGTGTGGG + Intergenic
950677025 3:14560488-14560510 GCTTGCCGTGGCTGGGGATTGGG - Intergenic
954615167 3:51965826-51965848 TGCTGCTGGGGTGGGGGATTTGG + Intronic
957346328 3:78965998-78966020 GGCTGCTGCAGCTGGGGATTGGG - Intronic
963880259 3:150520589-150520611 GGGTGGCGCGGCCGGGGTTTGGG - Intergenic
968078927 3:195833532-195833554 GGCTTACACAGCGGGGGATTAGG + Intergenic
968078940 3:195833581-195833603 GGCTTACACAGCGGGGGATTGGG + Intergenic
968078991 3:195833776-195833798 GGCTTACACAGCGGGGGATTGGG + Intergenic
968727687 4:2255887-2255909 GGCTGCCGCTGCCGGGGAGCTGG + Intronic
968752446 4:2397027-2397049 GACTGCCACGGCCGGGGATCAGG + Intronic
970333123 4:15004117-15004139 GGCGGCGGCGGCGGCGGCTTCGG + Exonic
971457933 4:26861322-26861344 GGCCGCCGCGGCGGGAGAGGAGG - Exonic
975778977 4:77819655-77819677 TGCTGCGGCGGCGGGGGAGGCGG + Intergenic
977470665 4:97438165-97438187 GGAGCCCACGGCGGGGGATTGGG + Intronic
980355621 4:131729899-131729921 GGTTGCGGCGGCGGCGGCTTCGG - Intergenic
981782206 4:148442729-148442751 CGCAGCCGCGGCGGGAGCTTGGG + Intronic
981791981 4:148548395-148548417 GGCTGCAAGGGCTGGGGATTGGG + Intergenic
983254287 4:165379810-165379832 GGCTGGGGTGGCGGGGGATGGGG + Intronic
986748173 5:10761662-10761684 CGCTGCCGCGGCAGGGGCTGAGG - Intergenic
995106243 5:108381030-108381052 CGCTGCGGCGGCGGGGGCTGCGG - Exonic
996862651 5:128083702-128083724 GGCTGCGGCGGCGGCGGCTCCGG - Intergenic
997500741 5:134371520-134371542 GGCCGCCGCGCCGGGGGGTGGGG + Exonic
997653008 5:135536026-135536048 GGCTGCCGCGGGGGCGGAGGTGG - Intergenic
1001688741 5:173616405-173616427 GGCGGCGGCGGCGGGGGAACTGG - Exonic
1006154819 6:32008350-32008372 GGCTGCAGCCCCGGGGGATGGGG + Intergenic
1006161131 6:32041085-32041107 GGCTGCAGCCCCGGGGGATGGGG + Exonic
1006336981 6:33425968-33425990 GGCTGGCGGGGCGGGGGCGTCGG + Intronic
1006475271 6:34248973-34248995 GGCTGCAGCGGCGGGAGGTAAGG - Exonic
1011277096 6:85642482-85642504 GGTCGCCGCGGCGCGGGAGTGGG - Intronic
1013048823 6:106512400-106512422 GGCGTCCGCGCCGGGGGAGTCGG - Exonic
1017164130 6:151391430-151391452 TGCTGCTGCGGCGGGGGGTGTGG + Exonic
1017662424 6:156687447-156687469 GGCCGCCGCGGCCGGGGCGTGGG - Intergenic
1017817859 6:158028163-158028185 GGCTGCAGCGGGGAGGGATTTGG + Intronic
1018628718 6:165804759-165804781 GGGAGCGGCGGCGGGGGACTGGG + Intronic
1019565310 7:1676036-1676058 GGCTGCCTGGGAGGGGGACTGGG + Intergenic
1023615098 7:42011750-42011772 GGCTGGCGGGGAGGGGGAATGGG + Intronic
1024208502 7:47184029-47184051 GGCTGCAGTGGCGGGGGGTGGGG - Intergenic
1027228599 7:76260041-76260063 GGCCGCCGCGGCGGGGGTGGGGG + Intronic
1028585567 7:92447889-92447911 GGCAGCGGCGGCGGCGGCTTCGG + Exonic
1032037755 7:128532002-128532024 GGCGGCCCCGGCCTGGGATTGGG + Intergenic
1033099677 7:138460062-138460084 GTCGGCCGCGGCGGGAGGTTGGG - Intergenic
1033174125 7:139109351-139109373 CTCTGCCGCGGCGCGGGACTCGG + Exonic
1033299841 7:140176418-140176440 GGCGGGCGCGGCGGGGGCGTCGG - Intronic
1034977351 7:155456223-155456245 GGCTGCCTCTGCGGGGGTCTGGG + Intergenic
1041157396 8:55002747-55002769 GGCTGCCTCGGTGGTGAATTGGG - Intergenic
1043464036 8:80487189-80487211 GGCGGCGGCGGCGGGGGTCTCGG + Exonic
1043581538 8:81721184-81721206 GTCTCCCGCGGCCGGGGATGGGG + Intronic
1058974099 9:110109934-110109956 GGCTGGAGGGGAGGGGGATTGGG + Intronic
1060982793 9:127803243-127803265 GGCCGCCGGGGCTGGGAATTCGG + Intronic
1062627082 9:137448219-137448241 GGCGGCCGCGGTGGAGGATCAGG + Exonic
1203471026 Un_GL000220v1:115508-115530 GGCGGCGGCGGCGGGGGTGTGGG + Intergenic
1203478847 Un_GL000220v1:159480-159502 GGCGGCGGCGGCGGGGGTGTGGG + Intergenic
1190072751 X:47292490-47292512 GGCTGCTGGGGCGGAGGGTTCGG + Intergenic
1195387261 X:104324899-104324921 GGCTGCTGGGGCGGGGGTTAGGG - Intergenic
1197526826 X:127575009-127575031 GGCTGAGGTGGCGGGGGGTTTGG - Intergenic
1200572002 Y:4843524-4843546 GGCTGCCGCTGCTGGGGGATGGG - Intergenic