ID: 1130531405

View in Genome Browser
Species Human (GRCh38)
Location 15:84749529-84749551
Sequence CCAAACATGCTTCCCTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 137}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130531405_1130531414 20 Left 1130531405 15:84749529-84749551 CCCACCCAGGGAAGCATGTTTGG 0: 1
1: 0
2: 1
3: 13
4: 137
Right 1130531414 15:84749572-84749594 TAGGACTGGCAGTAGAAGAATGG 0: 1
1: 0
2: 1
3: 15
4: 205
1130531405_1130531418 29 Left 1130531405 15:84749529-84749551 CCCACCCAGGGAAGCATGTTTGG 0: 1
1: 0
2: 1
3: 13
4: 137
Right 1130531418 15:84749581-84749603 CAGTAGAAGAATGGGACTTGGGG 0: 1
1: 0
2: 1
3: 21
4: 181
1130531405_1130531416 27 Left 1130531405 15:84749529-84749551 CCCACCCAGGGAAGCATGTTTGG 0: 1
1: 0
2: 1
3: 13
4: 137
Right 1130531416 15:84749579-84749601 GGCAGTAGAAGAATGGGACTTGG 0: 1
1: 0
2: 0
3: 16
4: 243
1130531405_1130531415 21 Left 1130531405 15:84749529-84749551 CCCACCCAGGGAAGCATGTTTGG 0: 1
1: 0
2: 1
3: 13
4: 137
Right 1130531415 15:84749573-84749595 AGGACTGGCAGTAGAAGAATGGG 0: 1
1: 0
2: 0
3: 7
4: 204
1130531405_1130531413 6 Left 1130531405 15:84749529-84749551 CCCACCCAGGGAAGCATGTTTGG 0: 1
1: 0
2: 1
3: 13
4: 137
Right 1130531413 15:84749558-84749580 GGACTAGTCTAGAATAGGACTGG 0: 1
1: 0
2: 0
3: 3
4: 35
1130531405_1130531411 1 Left 1130531405 15:84749529-84749551 CCCACCCAGGGAAGCATGTTTGG 0: 1
1: 0
2: 1
3: 13
4: 137
Right 1130531411 15:84749553-84749575 ATCCAGGACTAGTCTAGAATAGG 0: 1
1: 0
2: 0
3: 2
4: 73
1130531405_1130531417 28 Left 1130531405 15:84749529-84749551 CCCACCCAGGGAAGCATGTTTGG 0: 1
1: 0
2: 1
3: 13
4: 137
Right 1130531417 15:84749580-84749602 GCAGTAGAAGAATGGGACTTGGG 0: 1
1: 0
2: 0
3: 17
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130531405 Original CRISPR CCAAACATGCTTCCCTGGGT GGG (reversed) Intronic
902548312 1:17204425-17204447 CCAAGAATGCTTGCCTGGGGTGG + Intergenic
904983486 1:34525855-34525877 GCAAACCTGCTTCCCAGGATGGG + Intergenic
905241354 1:36583505-36583527 CCAGGGAGGCTTCCCTGGGTGGG + Intergenic
906085875 1:43134321-43134343 TCAAACATGCATTCCTGGGGTGG - Intergenic
909063408 1:70904953-70904975 GAAAACATGGTTTCCTGGGTTGG + Intronic
910473384 1:87579204-87579226 CCAATCATGATTCCCTTAGTGGG - Intergenic
911538566 1:99130404-99130426 CCAGTACTGCTTCCCTGGGTCGG + Intergenic
914082199 1:144419327-144419349 TCAAACAAGCGTCCCTGGGTGGG - Intergenic
914098906 1:144567506-144567528 TCAAACAAGCGTCCCTGGGTGGG + Intergenic
914177102 1:145287826-145287848 TCAAAGAGGCGTCCCTGGGTGGG - Intergenic
914300079 1:146370161-146370183 TCGAACAAGCGTCCCTGGGTGGG - Intergenic
914531829 1:148529317-148529339 TCGAACAAGCGTCCCTGGGTGGG - Intergenic
916078712 1:161218615-161218637 CCCCCCATGCCTCCCTGGGTGGG + Intronic
916715522 1:167443820-167443842 CCCAACATAATTCCCTGTGTAGG + Intronic
921518048 1:216122183-216122205 CCAGACATTTTTACCTGGGTGGG + Intronic
921623230 1:217349512-217349534 TTAACCATCCTTCCCTGGGTCGG - Intergenic
924146985 1:241086616-241086638 CCAAACATATTCCTCTGGGTGGG - Intronic
1066370821 10:34816480-34816502 GCAATCAAGCTCCCCTGGGTTGG + Intergenic
1067217559 10:44315801-44315823 CCAAACATGTTGCCCTCCGTTGG + Intergenic
1070243473 10:74707465-74707487 CAACATATGCTTCCCTGGCTGGG + Intronic
1070248363 10:74752519-74752541 CAACACATGCTTCCCTGGCCAGG - Intergenic
1072661705 10:97367277-97367299 CCAGTCATGCTTCCCTCGGGTGG + Intronic
1076034780 10:127190398-127190420 CCAATCAGGATTCCCTGAGTTGG + Intronic
1077735544 11:4786798-4786820 CCTAACAGGCTTCCCTGGGCTGG + Intronic
1080605735 11:33863497-33863519 CTCAACAAGCTTCCATGGGTTGG + Intronic
1084444827 11:69197395-69197417 CCTAACATGCTCCCTTGGCTAGG - Intergenic
1084943991 11:72629185-72629207 CCCATGAGGCTTCCCTGGGTCGG - Intronic
1088300720 11:108355556-108355578 CCTGCCATGCTTCCCTGGGGAGG - Exonic
1088408922 11:109511902-109511924 CCTCAGATGCTTCCCTGTGTTGG - Intergenic
1088913978 11:114213016-114213038 ACAGACAAGCTTCCATGGGTGGG - Intronic
1090640605 11:128726227-128726249 CCACCCATGCTCCCCTGTGTAGG + Intronic
1091374028 12:14711-14733 TCAGACCTGCTTCCCTGGGAGGG - Intergenic
1091681947 12:2533574-2533596 CCAAGCAGCCTTCCCTGGGAGGG - Intronic
1092884481 12:12913212-12913234 CCAACCCTTCTTGCCTGGGTAGG + Exonic
1092902874 12:13076224-13076246 GCACACATCCTTCCCTGGGTGGG - Intronic
1101253103 12:102954391-102954413 CCACACACCCTTTCCTGGGTGGG + Intronic
1101871588 12:108570218-108570240 ACAAACATTCATCCCTGGCTTGG + Intergenic
1104115988 12:125749334-125749356 CCAAAGCTGCTTTCCTGGGCTGG - Intergenic
1107023790 13:35778720-35778742 CCAACCCTGCCTCCCTGTGTTGG - Intronic
1108595118 13:51942806-51942828 CCTAAAATCCTTCCCTGGGTGGG + Intronic
1112497636 13:99917319-99917341 CCAAACATTTTTCCCCGGGAGGG - Intergenic
1115571406 14:34670228-34670250 CCACACATCCTATCCTGGGTGGG - Intergenic
1117242526 14:53849135-53849157 CCAACTATGCTCCCCAGGGTAGG - Intergenic
1121238311 14:92409628-92409650 CCTAACATGCTCCCCAGGATAGG + Intronic
1122080457 14:99263378-99263400 CAAAACATGCTTCCCAGTGTGGG + Intronic
1123552757 15:21398569-21398591 CCATCCATGCTTCCTTGTGTGGG + Intergenic
1123589003 15:21835957-21835979 CCATCCATGCTTCCTTGTGTGGG + Intergenic
1124012958 15:25853437-25853459 CCAAACATGCTTCTCAGTGAAGG + Intronic
1124359448 15:29025012-29025034 CTAAACATGCTTTGGTGGGTTGG - Intronic
1125199497 15:37089116-37089138 CCAGCCATGCTTCCTTGAGTTGG + Intronic
1129109704 15:73330210-73330232 CCAGATATGCTTCCCTTGGGGGG + Intronic
1129959258 15:79668475-79668497 CTAGAAATGCTTCCCTGGGAAGG + Intergenic
1130531405 15:84749529-84749551 CCAAACATGCTTCCCTGGGTGGG - Intronic
1202961107 15_KI270727v1_random:125789-125811 CCATCCATGCTTCCTTGTGTGGG + Intergenic
1132454330 16:14282-14304 TCAGACCTGCTTCCCTGGGAGGG - Exonic
1133479506 16:6156351-6156373 CCAACCATGATTCACTGGGTGGG - Intronic
1140860596 16:79014296-79014318 CAAAAGATGCTTTCCTGGGGTGG + Intronic
1141576148 16:84964603-84964625 CCATACGTGCTGCCCTGGGAGGG + Intergenic
1142397893 16:89843139-89843161 CCCAAGATGCTGCGCTGGGTGGG - Intronic
1143419303 17:6776406-6776428 CCAAAGATGCTTCCCAGAGGGGG - Intronic
1144304883 17:13960276-13960298 CCACATAAGCTTCCCTGGGGTGG + Intergenic
1145776862 17:27535129-27535151 AAAATCATGCTTTCCTGGGTGGG + Intronic
1147244095 17:39109209-39109231 CCAGCCATGCTTCCCTGTGCTGG - Intronic
1148936622 17:51168286-51168308 CCGACCATTCTTCCCTGGGCTGG + Exonic
1149366682 17:55952359-55952381 GAAAACATGGTTTCCTGGGTCGG + Intergenic
1150125006 17:62629678-62629700 CTGAACAGGCTTCCCAGGGTAGG - Intronic
1153821858 18:8839003-8839025 ACTAAGAGGCTTCCCTGGGTAGG + Intergenic
1157347621 18:46853875-46853897 CCATACATGTTTCCCCGGGTGGG - Intronic
1160333622 18:78017915-78017937 CCTCACCTCCTTCCCTGGGTGGG + Intergenic
1163554651 19:17985095-17985117 CCCAAGCTGCTTCCCTGGATGGG - Intronic
1165717511 19:38055971-38055993 CCAAACATACTGCCCTGAGACGG + Intronic
1168583840 19:57577032-57577054 CCAACCTTCCTTCCCTGGGCTGG + Intronic
926738756 2:16094018-16094040 CCAAAGCTGCTGCCCTGGGTGGG - Intergenic
928362591 2:30678112-30678134 CCACAAATCCCTCCCTGGGTTGG + Intergenic
929044701 2:37778192-37778214 CCAGCCATGCTTCCCAGGGGAGG - Intergenic
931701183 2:64910374-64910396 CCATACCTGGTTCCATGGGTGGG - Intergenic
932512204 2:72304019-72304041 GCAGAGCTGCTTCCCTGGGTGGG + Intronic
933187308 2:79292219-79292241 CCAACACTGCTTCCTTGGGTAGG - Intronic
936568783 2:113598818-113598840 TCAGACCTGCTTCCCTGGGAGGG + Intergenic
937016585 2:118611395-118611417 CCAAACATCATTCTATGGGTTGG + Intergenic
937970718 2:127546740-127546762 CCTCACCTGCTTTCCTGGGTAGG + Intronic
938478201 2:131635011-131635033 CCATCCCTGCTTCCCTGAGTGGG - Intergenic
943937573 2:193940918-193940940 GGAAACATGCTTACATGGGTAGG - Intergenic
945946464 2:216000260-216000282 CCCAACATGAGTTCCTGGGTGGG + Intronic
947300920 2:228687924-228687946 CCAAAGATGCTTCTCTGTATAGG + Intergenic
947673927 2:231960999-231961021 CTCAACACGCTTCCCTGGGCGGG + Intergenic
1169570383 20:6899401-6899423 CAAACCATGCTTCCTTGGGTAGG - Intergenic
1172450201 20:35016968-35016990 CCAAACACTCTTCCCTGTGCAGG - Intronic
1176820721 21:13652620-13652642 CCATCCATGCTTCTCTGAGTGGG - Intergenic
1177312336 21:19413484-19413506 CCAAGCCTGCTTTCATGGGTTGG - Intergenic
1179380980 21:40898677-40898699 CTAAACATGCTCCCCTTGGGTGG - Intergenic
1180902254 22:19382896-19382918 CCAAACATATTTCCCTGTGGGGG - Intronic
1184080349 22:42214926-42214948 CCAAAGCTGCTCCCCTGGGGGGG + Exonic
949891801 3:8738716-8738738 CCCAACATTCTTCCCAGTGTTGG - Intronic
950430443 3:12947847-12947869 CCAAACATGTTTTCCTGTGATGG + Intronic
953347621 3:42189298-42189320 CAACACATGCCTCCCTGGCTGGG + Intronic
953413756 3:42703921-42703943 CCATTCATGCTTCTCAGGGTCGG - Intronic
954181030 3:48881487-48881509 TCAAAGATGCCTCCCTGGGATGG - Intronic
954882118 3:53843578-53843600 TCAAACCAGCTCCCCTGGGTGGG + Intronic
956380384 3:68658857-68658879 CCAAACATGCTGCTCCGAGTTGG - Intergenic
964627070 3:158769990-158770012 CCAAACAGGCTTTACTGGGAAGG - Intronic
965288863 3:166850041-166850063 ACATACATGGTTTCCTGGGTAGG + Intergenic
968663733 4:1809819-1809841 CCACACGTGCTTCCCTGAATGGG - Intergenic
971388585 4:26164074-26164096 CCAAAAATGCTTCTGTTGGTAGG + Intronic
975991457 4:80263706-80263728 CCAACCTTGCTTTCCTGGCTGGG + Intergenic
979878125 4:125919173-125919195 ACATACATTCTTCCCTGAGTGGG - Intergenic
980002713 4:127509130-127509152 CCAAAAATCCTTCACTGGATAGG + Intergenic
980244723 4:130224227-130224249 CCAAACATTGTTTCCTGGGAAGG + Intergenic
982555560 4:156858477-156858499 CCAAACATGTTTCACTAAGTGGG - Intronic
982655101 4:158138016-158138038 CTAGAGATTCTTCCCTGGGTTGG - Intronic
984029712 4:174587573-174587595 CTAAACATGCCTTCCTGGGATGG - Intergenic
992562578 5:77967068-77967090 CCAAACATGCTGACATGGTTTGG - Intergenic
994592997 5:101795411-101795433 CCAACCTTGCTTCCCAGGGATGG + Intergenic
996783183 5:127210839-127210861 CCGAACATGCTCCCCTATGTAGG - Intergenic
997337666 5:133119348-133119370 CCAAACTGGCCTCCCTGGGTGGG + Intergenic
999503021 5:152165628-152165650 CCAAACCTGTTTCGCTGGTTTGG + Intergenic
1001057899 5:168464583-168464605 CAAAACAGGCTTCCCAGGGAAGG + Intronic
1003136517 6:3438766-3438788 CCAAACATGCTTTCCTAGGTGGG + Intronic
1004193775 6:13486874-13486896 GCAGCCATGCTTCCCGGGGTGGG - Exonic
1004409295 6:15365727-15365749 ACAGACATGCTTCCCAGGTTAGG - Intronic
1009931517 6:70181976-70181998 CCAAACTTCATTCCCTGGCTTGG - Intronic
1010092584 6:72002558-72002580 CCACGCATGCTTCCCTGACTGGG - Intronic
1016901759 6:149109728-149109750 TTAGACATGCTTCCATGGGTGGG - Intergenic
1017675325 6:156807150-156807172 ACAAAGATGCTTCACTGGGTGGG - Intronic
1018423126 6:163656964-163656986 CAAAAAATGCTTTCCTGTGTGGG - Intergenic
1018728186 6:166629182-166629204 CCGACCATGCTTCCCTCGGAAGG + Intronic
1019500456 7:1361966-1361988 CCAGAGATGCTTCCCGGCGTGGG - Intergenic
1026131637 7:67625760-67625782 CCACACTTGCTTCTCTGGGAGGG + Intergenic
1028789220 7:94834536-94834558 CAGAACCTGCTTCCCTGGTTTGG + Intergenic
1028930711 7:96409754-96409776 TCAACCATGCTTCCCTGTGCAGG - Intergenic
1029956448 7:104645162-104645184 CCAGGCATTCTTCACTGGGTGGG + Intronic
1035271114 7:157720512-157720534 CCGACCCTGCTTCCCTGCGTAGG + Intronic
1036204319 8:6794149-6794171 CCAAACAGGCACCCCTGGGTGGG - Intergenic
1036448906 8:8847981-8848003 CCAAACATCCTTCCCTGTTAGGG + Intronic
1036811622 8:11870821-11870843 GTAAAAATGCTTGCCTGGGTGGG - Intergenic
1038760608 8:30382159-30382181 TAAGCCATGCTTCCCTGGGTGGG + Intergenic
1042986160 8:74585190-74585212 ACAAACATGATTCCCTTTGTCGG + Intergenic
1046827876 8:118711724-118711746 TGAAACATGCCTCCCAGGGTAGG + Intergenic
1048843533 8:138585246-138585268 GGAAAGATGCTTTCCTGGGTTGG - Intergenic
1049408477 8:142462056-142462078 CCAGACACGCTTGGCTGGGTGGG - Intronic
1049686518 8:143941394-143941416 CCAAAGATGCCGCCCTGGGCCGG + Intronic
1049883746 9:14707-14729 TCAGACCTGCTTCCCTGGGAGGG - Intergenic
1055574619 9:77648508-77648530 CCACACTTGCCTCCCTGGCTGGG + Intergenic
1057014768 9:91642122-91642144 TCATCCAGGCTTCCCTGGGTAGG - Intronic
1058065686 9:100545497-100545519 GAAAACATGGTTTCCTGGGTAGG - Intronic
1058798451 9:108521017-108521039 CCAAAGATGTTACCCTGGGAGGG + Intergenic
1059981360 9:119775674-119775696 CAAAACATGTTTCCCGGGGAAGG + Intergenic
1203526635 Un_GL000213v1:96945-96967 CCATCCATGCTTCTCTGAGTGGG + Intergenic
1190599393 X:52074162-52074184 CCAAACTTGCATCCCGGGGATGG + Intergenic
1190609431 X:52179911-52179933 CCAAACTTGCATCCCGGGGATGG - Intergenic
1199419561 X:147628997-147629019 CCACTCACTCTTCCCTGGGTTGG + Intergenic
1200402068 X:156025452-156025474 TCAGACCTGCTTCCCTGGGAGGG + Intergenic