ID: 1130536144

View in Genome Browser
Species Human (GRCh38)
Location 15:84786379-84786401
Sequence GCTTGCAAGGATGAGTTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 351}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130536137_1130536144 21 Left 1130536137 15:84786335-84786357 CCATGCGTAAGGAAGATGCTGTG 0: 1
1: 0
2: 0
3: 6
4: 105
Right 1130536144 15:84786379-84786401 GCTTGCAAGGATGAGTTTGGAGG 0: 1
1: 0
2: 0
3: 31
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130536144 Original CRISPR GCTTGCAAGGATGAGTTTGG AGG Intronic
900712443 1:4122863-4122885 CCTTGCAAAGATGACTCTGGAGG + Intergenic
900879392 1:5369695-5369717 GCTTGGAAGGCTGAGGTGGGAGG + Intergenic
901784861 1:11617802-11617824 GCTTGCCAGGATGATGTGGGTGG - Intergenic
901826866 1:11867666-11867688 ACTTGCAAGGCTGAGGTGGGAGG + Intergenic
904723785 1:32531322-32531344 ACTTGGAAGGCTGAGGTTGGAGG - Intronic
905649659 1:39647722-39647744 GCCTGGAAGGATCAGGTTGGGGG - Intergenic
907936926 1:59049782-59049804 GCTTCCAGGGATTATTTTGGGGG + Intergenic
909941508 1:81616783-81616805 ACTTGCTAGGCTGAGGTTGGAGG - Intronic
910265801 1:85335851-85335873 GCTTGGAAGGCTGAGGTGGGAGG + Intronic
910718510 1:90258412-90258434 GTGTCCAAGGAGGAGTTTGGAGG + Intergenic
910882954 1:91938946-91938968 ACTTGGAAGGCTGAGGTTGGAGG + Intergenic
911616722 1:100020915-100020937 AGTGGGAAGGATGAGTTTGGAGG + Intronic
912792056 1:112662215-112662237 GCTTGGGAGGATGAGGTGGGAGG - Intronic
912877325 1:113373400-113373422 GCTTGGGAGGATGAGGTGGGAGG + Intergenic
913416943 1:118619226-118619248 GCCTGCAGGGGTGAGGTTGGTGG + Intergenic
915031879 1:152886787-152886809 GCTTCCACCGATGAGTTGGGGGG - Intergenic
915499831 1:156307925-156307947 CTTTGCAAGGATGAGATGGGTGG + Intergenic
916246129 1:162689905-162689927 GCTTGGGAGGCTGAGTTGGGAGG + Intronic
916540934 1:165753362-165753384 ACTTGCAAGGCTGAGGTAGGAGG + Intronic
917322429 1:173797118-173797140 ACTTGGAAGGCTGAGTTTGGAGG + Intergenic
917919420 1:179737974-179737996 GTTTACATGGATGAGCTTGGAGG + Intergenic
919088437 1:192949353-192949375 GGTTTCAAGGCTGAGTGTGGTGG + Intergenic
919468884 1:197954406-197954428 GCTTACAAAGTTGAGTTTTGAGG - Intergenic
923156505 1:231284112-231284134 GCTTGGGAGGATGAGGTGGGAGG - Intergenic
924134662 1:240951028-240951050 ACTTGGAAGGCTGAGTTGGGAGG - Intronic
924229765 1:241953686-241953708 ACTTGCAAGGCTGAGGTGGGAGG - Intergenic
1062935850 10:1388044-1388066 GCTTGTAAATATGAGTGTGGAGG - Intronic
1065214245 10:23435176-23435198 GCTTGGGAGGCTGAGTTGGGAGG - Intergenic
1065513213 10:26500100-26500122 GCTTGGGAGGCTGAGTTGGGAGG + Intronic
1068079842 10:52306496-52306518 ACTTGCAAGGCTGAGGTGGGAGG - Intergenic
1071537230 10:86443913-86443935 ACTTGCAAGGCTGAGGTGGGAGG + Intronic
1072159747 10:92754983-92755005 GCTTGACAGGATGGGTGTGGTGG - Intergenic
1072694479 10:97592919-97592941 GCTTGGGAGGCTGAGTTGGGAGG + Intronic
1073389691 10:103164134-103164156 GCTTGGAAGGCTGAGTTGGGAGG + Intronic
1075092399 10:119451051-119451073 GCTGGCAGGGATGACTGTGGGGG - Intronic
1075092425 10:119451120-119451142 GCTGGCATGGATGACTGTGGGGG - Intronic
1077640014 11:3873055-3873077 GCTTGGAAGGCTGAGGTAGGAGG - Intronic
1078227050 11:9401910-9401932 GATTGCAATGAATAGTTTGGGGG - Intronic
1078230810 11:9440725-9440747 CCTTTAAAGGAAGAGTTTGGAGG + Intronic
1079823778 11:25164670-25164692 ACTTGGAAGGATGAGTCTTGGGG - Intergenic
1080644454 11:34178226-34178248 GCCTGAAGGGATCAGTTTGGGGG - Intronic
1081049482 11:38319824-38319846 GCTTTACAGAATGAGTTTGGAGG - Intergenic
1081816080 11:45943229-45943251 GCTTGCAAGGCTGAGGTGGGAGG - Intronic
1082017287 11:47499904-47499926 GTTTGCAGGGAGGAGTTTGGAGG - Intronic
1083067676 11:59942366-59942388 GCTTGCTAGCTTGAGTTTTGTGG + Intergenic
1083794297 11:65005806-65005828 GCTTGGAAGGCTGAGGTGGGAGG + Intergenic
1084477244 11:69395948-69395970 GCTTTCAAGAATGAGTTTTCTGG - Intergenic
1084479047 11:69407509-69407531 GCTTGGAAGGCTGAGGTGGGAGG + Intergenic
1085130340 11:74032754-74032776 ACTTGCAAGGCTGAGGTGGGAGG + Intronic
1087598621 11:100285447-100285469 GTTTGCAAGGATGATTTAGAAGG - Intronic
1088263904 11:107971458-107971480 GCTTGGAAGGCTGAGGTGGGAGG + Intergenic
1088286580 11:108195734-108195756 GCTTGGGAGGATGAGGCTGGAGG - Intronic
1088527525 11:110772972-110772994 GCAAGCAAGGGTGAGTGTGGCGG - Intergenic
1088872186 11:113900352-113900374 CCTTGGAAGGATGAGTGTGGGGG - Intergenic
1089570548 11:119405835-119405857 GCTTGGAAGGCTGAGGTGGGAGG - Intergenic
1090029914 11:123197386-123197408 ACTTGGAAGGATGAGGTGGGAGG - Intergenic
1090270377 11:125381646-125381668 GCTTGCAGGGATGGGGTGGGAGG - Intronic
1090457799 11:126864982-126865004 GCTTGCAGGGAGGAGTGAGGAGG - Intronic
1091570684 12:1682867-1682889 ACTTGGAAGGCTGAGGTTGGAGG - Intergenic
1091774181 12:3173602-3173624 ACTTGGAAGGCTGAGGTTGGAGG - Intronic
1091997581 12:5006436-5006458 ACTTGAAAGGATGAGGTGGGAGG + Intergenic
1092678865 12:10954574-10954596 ACTTGCAAGGCTGAGTTGGGAGG - Intronic
1092778540 12:11964732-11964754 ACTTGCGAGGCTGAGGTTGGAGG - Intergenic
1094478586 12:30861800-30861822 GATTTCAATGATGAGTTTGGGGG + Intergenic
1094540066 12:31356025-31356047 GCTTGAAAGGCTGAGGTCGGAGG + Intergenic
1094724326 12:33097663-33097685 TCTTGCAGGAATGAGTTTTGTGG - Intergenic
1094786717 12:33857535-33857557 GCTTCATAGAATGAGTTTGGAGG + Intergenic
1095344489 12:41133587-41133609 GCTTCCAAGTATGAATTTTGTGG - Intergenic
1095579247 12:43777278-43777300 ACTTGGGAGGATGAGTTAGGAGG + Intronic
1095905516 12:47373508-47373530 ACTTGCAAGGCTGAGGTGGGAGG + Intergenic
1096885764 12:54717624-54717646 GCTGGCCAGAATGAGTTTGCTGG + Intergenic
1097064961 12:56314277-56314299 GCTTGGAAGGCTGAGGTGGGAGG - Intronic
1098269354 12:68754836-68754858 GCTTGGGAGGCTGAGGTTGGGGG - Intronic
1099048210 12:77750421-77750443 GCTTGGAAGGCTGAGGTAGGAGG + Intergenic
1100265912 12:92975899-92975921 CTTTGCAAGGCTGAGGTTGGAGG + Intergenic
1102362994 12:112304567-112304589 GCTTGGAAGGCTGAGATGGGAGG - Intronic
1102971327 12:117169748-117169770 GCTTGGAAGGCTGAGGTGGGAGG - Intronic
1103007543 12:117433881-117433903 GCATGCAAAGATGTGTTTAGGGG - Intronic
1103277198 12:119722405-119722427 GCTGGGATGGAGGAGTTTGGGGG - Intronic
1103837601 12:123835731-123835753 GCTTGGGAGGCTGAGTTAGGAGG - Intronic
1104361547 12:128137898-128137920 GTGTGCAAGGATGGGATTGGAGG - Intergenic
1105309771 13:19195938-19195960 ACTTGGAAGGCTGAGTTGGGAGG + Intergenic
1105510168 13:21045012-21045034 GCTTACAGAGATGAGTGTGGTGG - Intronic
1106695295 13:32166393-32166415 TCTAGCAAGGATGAGGGTGGGGG - Intronic
1107305241 13:39012126-39012148 TCTTGCAAGGATGATTGTGAAGG + Exonic
1109261494 13:60150128-60150150 GCTTGGAAGGCTGAGGTGGGAGG - Intronic
1109323465 13:60837990-60838012 GGTTGCAAGGATTAGTTTTGTGG + Intergenic
1110195000 13:72779226-72779248 ACTTGCGAGGCTGAGTTGGGAGG - Intronic
1111066238 13:83096114-83096136 ACTTGAAAGGCTGAGTTGGGAGG + Intergenic
1111601091 13:90475593-90475615 GCTTGGAAGGCTGGGTGTGGTGG + Intergenic
1112032461 13:95470354-95470376 GCTTGGAAGGCTGAGGTGGGAGG - Intronic
1112131348 13:96527196-96527218 ACTTGCAAAGCTGAGTTGGGAGG - Intronic
1112866111 13:103900763-103900785 GCTTTGCAGAATGAGTTTGGAGG - Intergenic
1113289574 13:108890038-108890060 ACTTGGAAGGATGAGGTGGGAGG - Intronic
1116580481 14:46635190-46635212 ACTTGGAAGGCTGAGTTTGGAGG - Intergenic
1117391542 14:55267284-55267306 ACTTGTAAGGATGAGGTGGGAGG + Intergenic
1119241855 14:73067025-73067047 GTTTTCAGGGATGATTTTGGAGG + Intronic
1119364825 14:74083100-74083122 GGTAGAAAGGATGAGTTTGAAGG - Intronic
1119579617 14:75765752-75765774 ACTTGGAAGGCTGAGGTTGGAGG + Intronic
1120383838 14:83818839-83818861 GCTTTCAATGATAATTTTGGGGG - Intergenic
1121482081 14:94286742-94286764 GCTTGAAAAGATGAGTTCTGTGG + Intronic
1121602299 14:95214456-95214478 ACTTGGAAGGCTGAGTTTGGAGG - Intronic
1121735684 14:96216512-96216534 GCTTGGAAGGATGAGGTGGGAGG + Intronic
1121805389 14:96815787-96815809 GCTTGGAAGGTTGAGGTGGGAGG + Intronic
1122221909 14:100244689-100244711 GCTTGGAAGGCTGAGGTGGGAGG - Intronic
1122253268 14:100456112-100456134 ACTTGCGAGGATGAGGTGGGAGG + Intronic
1122461878 14:101902756-101902778 TCTTGAAAGGCTCAGTTTGGAGG - Intronic
1123803803 15:23851125-23851147 GCTTTTTAGGATGACTTTGGAGG + Intergenic
1124467995 15:29956778-29956800 GCTTGGAAGGCTGAGGTGGGAGG + Intronic
1126236700 15:46394226-46394248 GCTTTGTAAGATGAGTTTGGAGG - Intergenic
1127341887 15:58054572-58054594 GCTTGCCAGAAAGAGTTGGGTGG - Intronic
1128140709 15:65298841-65298863 GCTTGGGAGGATGAGGTGGGAGG - Intronic
1129328022 15:74812353-74812375 GCTTGGAAGGATGAGCCTGGGGG + Intergenic
1129442440 15:75591487-75591509 GCTTGGAAGGCTGAGGTAGGAGG - Intergenic
1129464243 15:75715017-75715039 GCTTGGAAGACTGTGTTTGGAGG + Intergenic
1129721003 15:77877996-77878018 GCTTGGAAGACTGTGTTTGGAGG - Intergenic
1129753273 15:78080658-78080680 GCTTGCAGGGCTGAGTGTGGTGG + Intronic
1129968757 15:79759077-79759099 ACTTGAAAGGCTGAGTTGGGAGG - Intergenic
1130536144 15:84786379-84786401 GCTTGCAAGGATGAGTTTGGAGG + Intronic
1131137369 15:89948153-89948175 ACTTGCAAGGCTGAGGTGGGAGG + Intergenic
1131142101 15:89985294-89985316 ACTTGCAAGGCTGAGGTGGGAGG - Intergenic
1133252445 16:4492223-4492245 ACTTGGAAGGATGAATTGGGAGG + Intronic
1133493240 16:6292149-6292171 ACTTGGGAGGATGAGTTGGGAGG + Intronic
1133788845 16:8993703-8993725 GCTGGCCAGGGTGAGTGTGGTGG - Intergenic
1134909676 16:18013527-18013549 GCTTGAGAGGATGAGGTGGGAGG - Intergenic
1135398182 16:22147129-22147151 CCTTGCAAGGTTGAGGTGGGAGG - Intronic
1135537822 16:23307804-23307826 GCTTGCAAGGCTGAGGCAGGAGG + Intronic
1135637350 16:24089664-24089686 ACTTGGAAGGCTGAGTTGGGAGG + Intronic
1135678438 16:24436969-24436991 GCTTGGGAGGCTGAGGTTGGAGG + Intergenic
1136512004 16:30743840-30743862 GCTGGCCAGGATGAGTTTCCGGG - Intronic
1136679168 16:31945407-31945429 GCTATCCAGGCTGAGTTTGGGGG - Intergenic
1137257887 16:46792359-46792381 GCTTGGAAGGCTGAGATGGGAGG + Intergenic
1138018626 16:53456065-53456087 ACTTGCGAGGCTGAGTTAGGAGG + Intronic
1139898281 16:70306258-70306280 ACTTGCAAGGCTGAGGTGGGAGG - Intronic
1140100156 16:71909214-71909236 ACTTGCAAGGGTGAGGTGGGAGG - Intronic
1140120963 16:72082636-72082658 TCTTGCAAGGATCAGATTGAGGG - Intronic
1140354557 16:74294164-74294186 ACTTGGAAGGCTGAGGTTGGAGG - Intergenic
1140831730 16:78757933-78757955 GTTTCCAAATATGAGTTTGGGGG + Intronic
1142288485 16:89181532-89181554 GCTTGGAAGGCTGAGGTGGGAGG + Intronic
1143835543 17:9689518-9689540 ACTTGCAAGGATGAGGTGGGAGG - Intronic
1143901671 17:10179084-10179106 GTTTGCAAGGCTGAGGTGGGCGG + Intronic
1144617916 17:16793579-16793601 GCTTGGGAGGCTGAGGTTGGAGG + Intronic
1144894788 17:18522103-18522125 GCTTGGGAGGCTGAGGTTGGAGG - Intergenic
1145114831 17:20199507-20199529 ACTTGGAAGGATGAGGTAGGAGG - Intronic
1145137436 17:20422131-20422153 GCTTGGGAGGCTGAGGTTGGAGG + Intergenic
1146827881 17:36039765-36039787 ACTTGCGAGGATGAGGTGGGAGG - Intergenic
1147238699 17:39076400-39076422 GCTTGGGAGGCTGAGGTTGGAGG + Intronic
1147724882 17:42560893-42560915 GCTTGAAAGGCTGAGTGTGGAGG - Intergenic
1148274326 17:46290008-46290030 ACTTGGAAGGCTGAGGTTGGAGG + Intronic
1148478233 17:47942815-47942837 ACTTGGGAGGATGAGGTTGGAGG + Intronic
1149834678 17:59901908-59901930 GCTTGGAAGGCTGAGGTTGGAGG + Intronic
1150154892 17:62844722-62844744 GCTTGGGAGGCTGAGGTTGGTGG + Intergenic
1150408730 17:64924561-64924583 ACTTGGAAGGCTGAGGTTGGAGG - Intergenic
1152747395 17:82047749-82047771 GCTTCCAAAGAAGAGTCTGGTGG + Intergenic
1155028616 18:21964656-21964678 ACTTGGAAGGCTGAATTTGGAGG + Intergenic
1156724408 18:40110613-40110635 ACTTGGGAGGATGAGTTAGGAGG + Intergenic
1157371124 18:47113018-47113040 GATTGCAGGGATGATGTTGGTGG - Exonic
1157959340 18:52134956-52134978 GCATGCAAGCATAAGTTTTGAGG + Intergenic
1158445573 18:57517740-57517762 TCTTTCCAGGATGATTTTGGTGG + Intergenic
1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG + Exonic
1161428100 19:4215664-4215686 GCTTGGAAGGCTGAGGTGGGAGG + Intronic
1161971568 19:7584067-7584089 GCTTGGAAGGCTGAGGTGGGAGG + Intergenic
1162047470 19:8010114-8010136 GCTTGAAAGGCTGAGTTGAGAGG + Intronic
1162155880 19:8677659-8677681 GCTTGCAAGGGGGTGTTTGGGGG + Intergenic
1162586016 19:11559027-11559049 GCTTGGAAGGATGGGGTCGGGGG + Intronic
1162872474 19:13597156-13597178 ACTTGCAAGGCTGAGGTGGGAGG + Intronic
1163440667 19:17321074-17321096 GCTTGGAAGGCTGAGGTGGGAGG - Exonic
1165644671 19:37425258-37425280 GCTTGGAAGGCTGAGGTGGGAGG - Intronic
1165653454 19:37511435-37511457 CTTTGCAAGGATGAGGTGGGAGG + Intronic
1165844825 19:38811547-38811569 GCTTGGAAAGATGAGGTAGGAGG + Intronic
1167035153 19:46990848-46990870 CCCTGGAAGGATGAGCTTGGAGG - Intronic
1167438510 19:49494410-49494432 ACTTGCAAGGCTGAGGTGGGAGG + Intergenic
1167532982 19:50030397-50030419 GCTTGAGAGGCTGAGGTTGGAGG + Intronic
1168498001 19:56870141-56870163 GCTGGCAAGGTTGGGTTTGGAGG - Intergenic
1168589269 19:57619080-57619102 CCTTGCCAGGAAGGGTTTGGAGG + Intronic
926902938 2:17776005-17776027 ACTTGGAAGGCTGAGTTGGGAGG + Intronic
927933441 2:27060556-27060578 GCTAACAAGGATGAGTATGCTGG - Intronic
928749177 2:34451801-34451823 GCTTCATAGAATGAGTTTGGAGG + Intergenic
930017903 2:46983489-46983511 GCTCCCAGGGATGAGTCTGGGGG + Intronic
930666103 2:54100409-54100431 ACTTGCAAGGCTGAGATTAGAGG - Intronic
931599197 2:63986277-63986299 GCCTGGAAGGATAAGTGTGGGGG - Intronic
932052628 2:68414039-68414061 GCTTGGAAGGCTGAGGTGGGAGG + Intergenic
935761858 2:106328012-106328034 GCTTGGGAGGATGAGGTAGGAGG + Intergenic
935939735 2:108225640-108225662 GCTTCAAAGTATGAATTTGGTGG - Intergenic
937047476 2:118859322-118859344 GCTCGCAAGGAAGAGGGTGGGGG + Intergenic
937117281 2:119416958-119416980 ACTTGGAAGGCTGAGTTGGGAGG - Intergenic
937374550 2:121326783-121326805 GCTTCCAAGGTTGAGCATGGTGG - Intergenic
937735194 2:125279408-125279430 TCTTGCCAGCATGAGTTGGGAGG + Intergenic
937827434 2:126381986-126382008 GTATATAAGGATGAGTTTGGAGG - Intergenic
938893606 2:135729432-135729454 GCTTGGAAGGCTGAGATGGGAGG - Intergenic
938973830 2:136456918-136456940 ACTTGGAAGGCTGAGGTTGGAGG - Intergenic
939811365 2:146836820-146836842 GCTTGCAAGGAGAATTTTGAGGG + Intergenic
940176666 2:150885073-150885095 GCTTGCACTGATGACTGTGGAGG - Intergenic
942049820 2:172129102-172129124 ACTTGGGAGGCTGAGTTTGGAGG - Intergenic
942540994 2:177015598-177015620 GCTTGGAAGAGTGACTTTGGGGG + Intergenic
943707804 2:191054017-191054039 ACTTGCAAGGCTGAGGTGGGAGG + Intronic
944214372 2:197239338-197239360 ACTTGGAAGGCTGAGGTTGGAGG - Intronic
944537985 2:200730073-200730095 GCTTGGGAGGCTGAGTTAGGAGG + Intergenic
945475935 2:210282666-210282688 GCTTGGAAGGCTGAGGTGGGAGG - Intergenic
945766231 2:213981269-213981291 GCTTGAATGTATGAGTTTGTGGG + Intronic
945789559 2:214288072-214288094 GCTTGGAAGGGTGGGATTGGGGG - Intronic
946048490 2:216841239-216841261 GCTTGAGATGATGAGTTGGGAGG - Intergenic
946180634 2:217947042-217947064 GCTTGGAAGGAAGAGTTGGGAGG - Intronic
946232592 2:218301676-218301698 ACTTGGAAGGATGAGGTGGGAGG + Intronic
947405313 2:229770077-229770099 ACTTGGAAGGCTGAGGTTGGAGG - Intronic
947725703 2:232398689-232398711 ACTTGCGAGGCTGAGTTGGGAGG - Intergenic
948073146 2:235143812-235143834 GCTTCTAAGAATGAGTTTGCTGG - Intergenic
948675950 2:239596778-239596800 GCTAGTGAGGCTGAGTTTGGTGG + Intergenic
1168751890 20:288404-288426 GCTGGCAGGGATGAGTGGGGAGG + Intronic
1168885046 20:1244099-1244121 ACTTGGAAGGATGTGATTGGTGG + Exonic
1169439733 20:5624080-5624102 GTTTGCAAGGCTGAGGTGGGAGG + Intergenic
1169815297 20:9650251-9650273 GCTTGCAAGGGAGACTTTGCTGG + Intronic
1170329534 20:15193397-15193419 GCTTGGAAGGCTGAGGTGGGAGG + Intronic
1170734028 20:18998235-18998257 GCTTGGGAGGCTGAGGTTGGAGG + Intergenic
1170928351 20:20745912-20745934 ACTGGCAAGAAGGAGTTTGGGGG - Intergenic
1171116686 20:22531133-22531155 CCATGGAAGGATGAGTTGGGAGG + Intergenic
1172166786 20:32904407-32904429 ACTTGCAAGGCTGAGGTGGGAGG - Intronic
1173657027 20:44706548-44706570 GCTGGCAAGGATGAGCGTGCAGG - Intergenic
1175029171 20:55935084-55935106 GCTGGCAAGGATAAGATGGGAGG - Intergenic
1176983396 21:15408646-15408668 GCTTGGAAAGATGGGTTAGGAGG + Intergenic
1177142276 21:17370139-17370161 GCTTGCGAGGCTGAGGTGGGAGG - Intergenic
1177674190 21:24274364-24274386 GCTAGAAAGAATGAGTTTAGTGG + Intergenic
1181911894 22:26245011-26245033 GCACGCAAGGATGGGTTTGAAGG + Intronic
1181915481 22:26276391-26276413 ACTTACAAGGATGTGCTTGGAGG - Intronic
1182570239 22:31231923-31231945 GCTTGCAAGGCTGAGGTGGGAGG - Intronic
1184231654 22:43161393-43161415 GGTTGCAGGGGTGGGTTTGGGGG + Intronic
1184768794 22:46586329-46586351 GCTTTCCAGGTTGAGATTGGTGG + Intronic
1185198979 22:49490682-49490704 GCTGGAAAGGCTGAGTGTGGGGG + Intronic
1185310004 22:50149058-50149080 GCTCACAAGGATGAGTCAGGAGG + Intronic
1185358682 22:50391503-50391525 GCTTGGAAGGCTGAGATGGGAGG + Intronic
949933235 3:9097097-9097119 ACTTGCAAGGCTGAGGCTGGAGG - Intronic
950275001 3:11653184-11653206 GGTTGGAAGGATGACTGTGGAGG - Intronic
951308361 3:21094947-21094969 GATTGCAAGGATCAGTTTTGAGG - Intergenic
951497328 3:23344761-23344783 GCTTGGAAGGCTGAGATGGGAGG + Intronic
952439712 3:33313552-33313574 GCTTGGAAGGCTGAGTCAGGAGG - Intronic
952515544 3:34101053-34101075 GCTTTCATGGATGACTTTGAGGG - Intergenic
954311300 3:49770088-49770110 GCTTGAGAGGCTGAGTTGGGAGG + Intronic
954543388 3:51411820-51411842 GATTGCCAGGATGAGTGCGGTGG + Intronic
955299977 3:57768922-57768944 GCTGGCAAGTATGAAATTGGCGG - Intronic
955327306 3:58019026-58019048 GCTTGGGAGGCTGAGTTGGGAGG + Intronic
959446096 3:106441561-106441583 GTTTGCAAAGAAGACTTTGGGGG - Intergenic
959447188 3:106454789-106454811 GCCTGCAAGGCTGAGGTGGGAGG + Intergenic
960097505 3:113702364-113702386 GCTTTCATGGATGACTTTGAGGG - Intergenic
960779242 3:121299870-121299892 ACTTGCAAGGCTGAGGTTGGAGG + Intronic
961238462 3:125389177-125389199 GCTTGAGAGGATGAGGTGGGAGG + Intergenic
961846425 3:129768078-129768100 ACTTGCAAGGCTGAGGTGGGAGG + Intronic
961949343 3:130731879-130731901 GCTTGGAAGGCTACGTTTGGAGG + Intronic
965010781 3:163087066-163087088 ACTTGCAAGGCTGAGATGGGAGG + Intergenic
966922108 3:184619221-184619243 GGTTGCCAGGTTGAATTTGGAGG - Intronic
967221341 3:187250456-187250478 GCTTCCAAGGGTGAGCTTGAAGG + Intronic
969325408 4:6441266-6441288 GCTTGAAGGGAGGAGTTTGGAGG - Intronic
970451322 4:16168899-16168921 GCTGGCAAGAGTGAGTCTGGAGG + Intronic
970708340 4:18832063-18832085 GCTAGCAAGGATGATATTTGTGG - Intergenic
971220707 4:24703690-24703712 ACTTCCAAGCATGATTTTGGTGG + Intergenic
971487089 4:27171466-27171488 GATTGAGAGAATGAGTTTGGCGG + Intergenic
972539363 4:40025785-40025807 GCTTGGAAGGTTGAGGTGGGAGG + Intergenic
973306385 4:48657277-48657299 GCTTGAAAGGCTGAGGTGGGAGG - Intronic
973538721 4:51911902-51911924 GCTTGCAAGGATGAGGGTGTTGG + Intronic
974063621 4:57057112-57057134 ACTTGGAAGGCTGAGTTGGGAGG - Intronic
974298416 4:60034370-60034392 GCTTGGATGACTGAGTTTGGTGG - Intergenic
975149694 4:71006697-71006719 ACTTGGAAGGCTGAGGTTGGAGG + Intronic
976597951 4:86911793-86911815 GCTTGGAAGGCTGAGGTGGGAGG - Intronic
976816604 4:89155457-89155479 GCTTGGAAGGCTGAGGTGGGAGG - Intergenic
977126358 4:93173736-93173758 GCTTGGGAGGATGAGGTTGGAGG - Intronic
977719026 4:100217166-100217188 GCTGGGAAGGGTGTGTTTGGCGG - Intergenic
978455501 4:108885802-108885824 GTCTGCAAAAATGAGTTTGGGGG - Intronic
978603056 4:110448793-110448815 ACTTGGAAGGCTGAGTTGGGAGG - Intronic
979574925 4:122278738-122278760 ACTTGGAAGGATGAGGTGGGAGG - Intronic
979913995 4:126406649-126406671 GCTTACAAAGCTTAGTTTGGTGG - Intergenic
981249477 4:142582652-142582674 CCTTGCAATAACGAGTTTGGTGG + Intronic
981329533 4:143492349-143492371 GCTTTGTAGAATGAGTTTGGAGG - Intergenic
981636840 4:146890891-146890913 GCTCACATGGTTGAGTTTGGTGG + Intronic
981928596 4:150166383-150166405 ACTTGGAAGGCTGAGTTAGGAGG + Intronic
982007180 4:151074997-151075019 GCTTGGAAGGCTGAGATGGGAGG + Intergenic
982128271 4:152203291-152203313 TCTTGGGAGGCTGAGTTTGGAGG + Intergenic
983870556 4:172820551-172820573 GCTTAGAAGGATAACTTTGGGGG + Intronic
984269216 4:177530216-177530238 CTTTGAAAGGATGAGTTGGGCGG - Intergenic
984611347 4:181843154-181843176 GAGTGTAAGGATGAGTTTGAAGG - Intergenic
984712176 4:182895178-182895200 ACTTGGAAGGCTGAGTTGGGAGG - Intronic
984785619 4:183564940-183564962 CCTTGGAAGGATGAGGTGGGCGG - Intergenic
985718621 5:1476741-1476763 GGTTGCAAGGACAAGTGTGGGGG + Intronic
986308604 5:6533960-6533982 TCTTGCAAGAAAGAATTTGGTGG - Intergenic
986659269 5:10044526-10044548 GCTGGCAAGGAGGTGTTTGAGGG - Intergenic
988487039 5:31675803-31675825 ACTTGCAAGGCCGAGGTTGGAGG - Intronic
990173785 5:53084440-53084462 GACTCCAGGGATGAGTTTGGAGG - Intronic
991069674 5:62463148-62463170 ACTTGCAAGGCTGAGGTGGGAGG - Intronic
991111300 5:62902481-62902503 GCTTGCAAACTAGAGTTTGGGGG - Intergenic
993971540 5:94425954-94425976 ACTTGGAAGGCTGAGTTGGGAGG - Intronic
994183526 5:96794295-96794317 ACTTGCAAGGCTGAGATGGGAGG - Intronic
995967163 5:117921594-117921616 GCTTGGAAGGATGAGTAGGTGGG + Intergenic
997138515 5:131353072-131353094 ACTTGGAAGGCTGAGTTTGGAGG - Intronic
998580144 5:143364812-143364834 GCTTGAGAGGCTGAGTTGGGAGG - Intronic
1001967361 5:175920602-175920624 GCTTGGAAGGCTGAGGTGGGAGG - Intronic
1002161004 5:177314133-177314155 GATTGCAGGGGGGAGTTTGGGGG - Intergenic
1003198430 6:3936091-3936113 ACTTGCAAGGCTGAGGTGGGAGG - Intergenic
1003380336 6:5619294-5619316 GATTGCAAGGAGGGGTTTGGTGG + Intronic
1003667747 6:8127320-8127342 GCTTGAAAGGCTGAGGTGGGAGG + Intergenic
1004372364 6:15063472-15063494 ACTTGGAAGGCTGAGGTTGGAGG + Intergenic
1005813565 6:29533160-29533182 CCTTGAATGGATGAGGTTGGTGG - Intergenic
1006822729 6:36911244-36911266 CTTTGCAAGGCTGAGGTTGGCGG + Intronic
1007352189 6:41282072-41282094 CCTCCCAAGGATGCGTTTGGTGG - Intronic
1008485275 6:52028618-52028640 GCTTGGGAGGCTGAGTTGGGAGG - Intronic
1010190738 6:73193943-73193965 GCTAGGAAGGCTGAGTTGGGAGG - Intronic
1010238543 6:73595819-73595841 CCTTGGAAGGCTGAGTTGGGAGG - Intronic
1011459441 6:87588478-87588500 GCTTGAAAGGCTGAGTCTGGAGG - Intronic
1014470462 6:121808045-121808067 GCTTGGAAGGCTGAGGTGGGAGG + Intergenic
1015391756 6:132690318-132690340 GCTTGCGAAGCTGGGTTTGGTGG - Intronic
1015908558 6:138143845-138143867 GCTTGGGAGGCTGAGTTGGGAGG + Intergenic
1016360436 6:143261465-143261487 CCCTGCAAGGCTGAATTTGGGGG + Intronic
1017010410 6:150059539-150059561 GCTTTCAAGAATGGGGTTGGAGG - Intergenic
1017776101 6:157681797-157681819 GCTTGCAAAGGTGAGTGAGGAGG - Intergenic
1018071254 6:160166611-160166633 GGTTGAAAGGAAGAGTGTGGGGG - Intergenic
1018312166 6:162522230-162522252 ACTTGGGAGGCTGAGTTTGGAGG - Intronic
1019831051 7:3330861-3330883 ACTTGGAAGGCTGAGTTGGGAGG + Intronic
1019970330 7:4535547-4535569 GCTTGTAAGGCTGAGGTAGGAGG + Intergenic
1022041339 7:26584406-26584428 GCTTGCTCTGATGAGTCTGGTGG + Intergenic
1023476989 7:40591238-40591260 GCATGCATGGATGACTTTGAGGG + Intronic
1024190258 7:46999592-46999614 GCTTTCAAGGAGGAGCATGGAGG + Intergenic
1025113188 7:56236385-56236407 ACTTGGAAGGATGAGGTGGGAGG + Intergenic
1027253113 7:76411458-76411480 ACTTGCAAGGCTGAGGTGGGAGG + Intronic
1029007475 7:97225731-97225753 GCTTGCATGGCTGAGGCTGGAGG + Intergenic
1029184063 7:98725994-98726016 ACTTGCAAGGGTGAGGTGGGGGG + Intergenic
1029205636 7:98867928-98867950 GCCTGGAAAGATGAATTTGGTGG - Intronic
1029697783 7:102225744-102225766 ACTTGCAAGGCTGAGGTGGGAGG + Intronic
1032040824 7:128559269-128559291 TCTTGCAAGGCTGAGTTGTGAGG - Intergenic
1034224610 7:149473127-149473149 GCTCGCGAGGCTGGGTTTGGGGG - Exonic
1034713936 7:153221797-153221819 GCTTGGTAGGTTGAGTATGGAGG + Intergenic
1035877997 8:3212455-3212477 GCTTGGGAGGATGAGGTAGGAGG - Intronic
1036526361 8:9538547-9538569 ACTTGGAAGGCTGAGGTTGGAGG - Intergenic
1036565586 8:9935270-9935292 GCTTGGAGGGATGAGTTAGAAGG + Intergenic
1036911825 8:12763800-12763822 GCTTGCAAGGCTGAGGCAGGAGG + Intergenic
1037803749 8:22048633-22048655 TCTAGCCAGGAGGAGTTTGGGGG - Exonic
1037848672 8:22307728-22307750 GATTGGAAGGATGAGGTGGGTGG - Intronic
1037861966 8:22411907-22411929 GGTCGCAAGGAAAAGTTTGGTGG - Intronic
1038239454 8:25795233-25795255 TCTTGCAAGGATGCCATTGGAGG - Intergenic
1039268274 8:35852532-35852554 GCTTCATAGAATGAGTTTGGGGG + Intergenic
1039798050 8:40932202-40932224 GCTTGGAAGGCTGAGGTAGGAGG + Intergenic
1039800617 8:40951687-40951709 TTTCACAAGGATGAGTTTGGAGG - Intergenic
1039851484 8:41369457-41369479 GCTTGGGAGGCTGAGGTTGGAGG + Intergenic
1039955812 8:42206591-42206613 GGTAACAAGGATGTGTTTGGTGG - Intronic
1040876572 8:52158726-52158748 GCAGGCAGGGATGAGCTTGGTGG - Intronic
1040935121 8:52774318-52774340 ACTTGAAAGGATGAGGTGGGAGG - Intergenic
1041718155 8:60950704-60950726 GCTTGCCATCATCAGTTTGGAGG + Intergenic
1041896799 8:62934267-62934289 GCTTGGAAGGCTGAGGTGGGAGG + Intronic
1042525147 8:69756916-69756938 GCTTGAATGGCAGAGTTTGGAGG - Intronic
1042545614 8:69948473-69948495 ACTTGCAAGGCTGAGGTGGGAGG + Intergenic
1043447922 8:80337460-80337482 ACTTGCAAGGCTGAGGTGGGAGG + Intergenic
1043882856 8:85564834-85564856 GCATGCACGGCTGAGTGTGGTGG - Intergenic
1047743811 8:127828737-127828759 ACATGGAAGGATGAGTCTGGGGG - Intergenic
1047964096 8:130032827-130032849 GCTTGGAAGGCTGAGGTGGGAGG + Intergenic
1048213058 8:132472598-132472620 GCTTGGAAGGATGAATGTGCAGG + Intronic
1049976290 9:863207-863229 GCTTGCGAGGCTGAGGTGGGAGG + Intronic
1050526105 9:6548028-6548050 ACTTGGGAGGATGAGTTAGGAGG + Intronic
1051455236 9:17247937-17247959 GCTTCCAAGGTTGAGGTTGGAGG - Intronic
1052104464 9:24495560-24495582 GGTTGCAAGGATGAGGTGGGTGG + Intergenic
1055773754 9:79745568-79745590 GTCTCCACGGATGAGTTTGGGGG - Intergenic
1056389173 9:86124697-86124719 GCTTGGGAGGATGAGATGGGAGG + Intergenic
1056992984 9:91427747-91427769 ACTTGGAAGGCTGAGGTTGGAGG - Intergenic
1058982037 9:110179031-110179053 GATGGCAAGCATGAGTTTGATGG + Intergenic
1059365425 9:113783095-113783117 GCTTCAAAGTATGAATTTGGTGG - Intergenic
1059566258 9:115385677-115385699 GCCTGCAAGGATGGGGGTGGGGG - Intronic
1060676443 9:125519518-125519540 GCTTGGAAGGCTGAGGTGGGAGG + Intronic
1061006581 9:127931454-127931476 GCTTGAATGGGAGAGTTTGGCGG - Intergenic
1185471868 X:388623-388645 GCTTGGAAGGCTGAGGTGGGAGG - Intergenic
1186673550 X:11792133-11792155 GCTTGGAAGGCTGAGGTGGGAGG + Intergenic
1188243690 X:27817641-27817663 GCTTGAAAGGCTGAGGTGGGAGG - Exonic
1188437484 X:30178969-30178991 GCATGCAAGGCTGTGTTTGAAGG - Intergenic
1190179352 X:48178331-48178353 ACTTGCAAGGCTGAGGTGGGAGG - Intergenic
1191752576 X:64559156-64559178 GCTTGCTAGGCTGGGCTTGGTGG - Intergenic
1192074363 X:67976457-67976479 GCTTGGAAGGCTGAGGTGGGAGG + Intergenic
1196249176 X:113438541-113438563 GATTGAAAGCATGAGTTTGTGGG - Intergenic
1196460707 X:115926688-115926710 GATTTCCAGGATGAGTGTGGTGG - Intergenic
1197541481 X:127768184-127768206 GCTTTGCAAGATGAGTTTGGAGG - Intergenic
1198477481 X:137009454-137009476 GCTTGGGAGGCTGAGTTTGGAGG + Intergenic
1198499768 X:137231985-137232007 CCTTGCAAGCAGGAGTTTGTTGG + Intergenic
1199949333 X:152694166-152694188 GCTTCAAAGTATGAATTTGGTGG + Intergenic
1199960343 X:152774283-152774305 GCTTCAAAGTATGAATTTGGTGG - Intergenic
1201298533 Y:12486337-12486359 GCTTTCAAAGATGTGTTTGCAGG + Intergenic
1201798096 Y:17923759-17923781 GCATGCCTGGATGAGTTTAGTGG - Intergenic
1201803457 Y:17982198-17982220 GCATGCCTGGATGAGTTTAGTGG + Intergenic
1201961758 Y:19688859-19688881 GCTTACGAAGATTAGTTTGGTGG + Intergenic
1202359421 Y:24092450-24092472 GCATGCCTGGATGAGTTTAGTGG - Intergenic
1202511357 Y:25577664-25577686 GCATGCCTGGATGAGTTTAGTGG + Intergenic