ID: 1130537698

View in Genome Browser
Species Human (GRCh38)
Location 15:84798806-84798828
Sequence GAACCCACTCCTGGCACTCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 180}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130537698_1130537706 24 Left 1130537698 15:84798806-84798828 CCAGGAGTGCCAGGAGTGGGTTC 0: 1
1: 0
2: 0
3: 12
4: 180
Right 1130537706 15:84798853-84798875 ACATGAAAAAGAGCCACGGTCGG 0: 1
1: 0
2: 0
3: 10
4: 142
1130537698_1130537703 20 Left 1130537698 15:84798806-84798828 CCAGGAGTGCCAGGAGTGGGTTC 0: 1
1: 0
2: 0
3: 12
4: 180
Right 1130537703 15:84798849-84798871 TCCCACATGAAAAAGAGCCACGG 0: 1
1: 0
2: 0
3: 21
4: 202
1130537698_1130537707 25 Left 1130537698 15:84798806-84798828 CCAGGAGTGCCAGGAGTGGGTTC 0: 1
1: 0
2: 0
3: 12
4: 180
Right 1130537707 15:84798854-84798876 CATGAAAAAGAGCCACGGTCGGG 0: 1
1: 0
2: 1
3: 8
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130537698 Original CRISPR GAACCCACTCCTGGCACTCC TGG (reversed) Exonic
900110416 1:1003130-1003152 GAGCCCACTCCAGGATCTCCGGG + Intergenic
900122946 1:1056895-1056917 GAACCAACCCTTGGCACTGCTGG + Intergenic
900536268 1:3179255-3179277 GACCCCAGTCCTGGCCCTGCTGG - Intronic
900962909 1:5937105-5937127 GAACTCAGTCCTGCCACACCTGG + Intronic
901491342 1:9597844-9597866 GATCACACTCCTGACCCTCCTGG + Intronic
901657908 1:10781153-10781175 GAGCCCCCTCCTCGCCCTCCAGG - Intronic
903263515 1:22143347-22143369 GAGCCCGCTCCAGGCACGCCTGG + Intronic
904403220 1:30270424-30270446 GAGCCCACTCCTGGAACTGTTGG + Intergenic
905675099 1:39819312-39819334 GAACACCTTCCTGGCTCTCCTGG - Intergenic
907043978 1:51288479-51288501 GGAACCACTCCTGGTCCTCCTGG + Intronic
907078311 1:51597900-51597922 GGACCCAATCCTTGCTCTCCAGG + Intronic
914851338 1:151316414-151316436 GAGCCCACTTCTGGCCCACCAGG - Exonic
921323593 1:213968301-213968323 AGACCCATTCCTGCCACTCCTGG + Intergenic
922500757 1:226095364-226095386 GAACACAGTCCTTGCCCTCCTGG - Intergenic
923019691 1:230153774-230153796 GTTCCCACTCCTGGGCCTCCTGG + Intronic
924246149 1:242087124-242087146 GAACCCATTTCTGACACTCTTGG + Exonic
1065189833 10:23199030-23199052 GAGCCCGCTCCTGGGACTCTGGG + Intergenic
1067539210 10:47139541-47139563 GAACCAACTCCGGACACACCTGG - Intergenic
1067559369 10:47294165-47294187 GAACCAACTCCGGACACACCGGG - Intergenic
1068421436 10:56799711-56799733 GAAGCCACTCTTGACCCTCCAGG - Intergenic
1068657698 10:59591837-59591859 GAACCCACCACTGCCACTACTGG + Intergenic
1070554466 10:77517157-77517179 GACCCTACCCTTGGCACTCCAGG + Intronic
1070594019 10:77819961-77819983 GTGCCCACTCCTGGAGCTCCGGG + Exonic
1070711476 10:78686260-78686282 GAGCCCACTCCCAGCCCTCCCGG + Intergenic
1074154515 10:110786771-110786793 GACCCCACTCCAGGCACTGAAGG + Intronic
1075087609 10:119423984-119424006 GAACCCAATCCTGGCTTTCATGG + Intronic
1076609434 10:131712061-131712083 GGACCCAGTCCTTGCTCTCCTGG - Intergenic
1076896598 10:133316285-133316307 GAACCAACTCCCGACACACCTGG + Intronic
1077019085 11:409605-409627 GTGCCCACTCCTAGCATTCCTGG + Intronic
1077332851 11:1990912-1990934 GCACCCACTGCTGGGCCTCCTGG + Intergenic
1081804321 11:45882107-45882129 GAAGCCAATCCTTGCATTCCAGG + Exonic
1082776534 11:57249268-57249290 GAAGCCAGTGCTGGGACTCCTGG - Intergenic
1084288781 11:68148427-68148449 AAACCCACTCCTTTCCCTCCAGG - Intergenic
1086547231 11:88012066-88012088 GACCCCACTCATGGCAGGCCAGG - Intergenic
1089688267 11:120170321-120170343 TAACCCATTCTTGGCACACCGGG + Exonic
1090332546 11:125943132-125943154 GAGGCCACTCCAGGGACTCCAGG + Intergenic
1202815834 11_KI270721v1_random:46088-46110 GCACCCACTGCTGGGCCTCCTGG + Intergenic
1093094940 12:14961220-14961242 GAAACCCCTCCAGGCACTCCCGG + Intronic
1099703136 12:86114944-86114966 GAACCCACTCCTGGAAATAGCGG + Intronic
1104760931 12:131297236-131297258 GAACCCACTCAAGGCCCACCAGG + Intergenic
1104818847 12:131663556-131663578 GAACCCACTCAAGGCCCACCAGG - Intergenic
1104835149 12:131785317-131785339 GCAGCCACTCCTGGCCCTCCAGG + Intronic
1106543363 13:30709999-30710021 GAACCCACTCTTGGAGCTGCAGG + Intergenic
1113888160 13:113671818-113671840 GCACTCACTCCTGTGACTCCTGG - Intronic
1116975181 14:51108220-51108242 GACCCCTTTCCTGGCACTCGTGG - Intergenic
1117413001 14:55467834-55467856 GAAGCCACTCATGGTACACCTGG - Intergenic
1117529807 14:56649062-56649084 GAACCCTGTCCAGGCACTGCAGG - Exonic
1119236455 14:73024187-73024209 GAGTCCTCTTCTGGCACTCCAGG + Exonic
1121104659 14:91272526-91272548 AAACCCTCTCCTGGCACCGCAGG + Exonic
1121839081 14:97117855-97117877 GCTCACACTCCTGGCACCCCTGG - Intergenic
1122714283 14:103684616-103684638 GACCCCAATTCTGGGACTCCTGG + Intronic
1123114501 14:105888488-105888510 GCACCCACTCCTGGGACTGAGGG - Intergenic
1123932294 15:25177746-25177768 CAATCCACTCCTGGGACTCGTGG + Intergenic
1123967298 15:25471909-25471931 GAACCCACACCTGGCCGGCCTGG + Intergenic
1125609249 15:40959755-40959777 CCACCGACTCCTGGCTCTCCAGG - Intergenic
1127794833 15:62428558-62428580 CAACCCACTCCAGACACACCGGG - Intronic
1128715990 15:69908371-69908393 GAACCCAGCCCTTGCCCTCCAGG + Intergenic
1128954884 15:71929807-71929829 GCACCCAGTCATGGCACTGCTGG + Intronic
1129350945 15:74955799-74955821 GGATCCTCTCCTGCCACTCCTGG + Exonic
1130537698 15:84798806-84798828 GAACCCACTCCTGGCACTCCTGG - Exonic
1131099855 15:89679381-89679403 GAAACAATTCCTGTCACTCCTGG + Exonic
1132279755 15:100602665-100602687 GACCCCACGGCTGGCACTTCGGG + Exonic
1133111458 16:3550406-3550428 GGACTCACTCCAGGCTCTCCAGG + Exonic
1134052428 16:11146181-11146203 GTCCCCACTCCCAGCACTCCAGG + Intronic
1134515233 16:14881757-14881779 CAACCCACTCCTAGCAGTCTTGG - Intronic
1134702906 16:16280402-16280424 CAACCCACTCCTAGCAGTCTTGG - Intronic
1134964637 16:18431713-18431735 CAACCCACTCCTAGCAGTCTTGG + Intronic
1134968924 16:18514248-18514270 CAACCCACTCCTAGCAGTCTTGG + Intronic
1135114896 16:19716111-19716133 TAACCCACTCCAGGCGCACCTGG + Intronic
1136079886 16:27844961-27844983 GACCCCATTCCTGGGACTACGGG - Exonic
1137559589 16:49494136-49494158 GAACCCACACCTGGGACCACTGG + Intronic
1138738661 16:59281074-59281096 CAACCCACTGCTGCCACTACTGG + Intergenic
1140126288 16:72121507-72121529 GAATCCATTCGTGGCACCCCAGG - Intronic
1146558492 17:33847945-33847967 GAACTCACTCCAGGCACTTTGGG + Intronic
1151317337 17:73331277-73331299 GAACCCACTCTTCTGACTCCAGG + Intergenic
1152039100 17:77891786-77891808 GGAGCCACTCCTGTGACTCCAGG - Intergenic
1152436605 17:80280116-80280138 GAGCCCACTCCTGCAGCTCCTGG + Intronic
1153014782 18:573767-573789 GAAGCCACTCCTGGGCCTCCTGG + Intergenic
1157815055 18:50724202-50724224 CAACCCACTACTGGCCCACCTGG + Intronic
1159088205 18:63818360-63818382 CAGTCCAGTCCTGGCACTCCAGG - Intergenic
1160441197 18:78894209-78894231 GCACACACTCCACGCACTCCAGG + Intergenic
1160788632 19:912837-912859 GGACACCCTCCTGGCGCTCCGGG - Intronic
1162721839 19:12667179-12667201 GATCCCATCCCTGGTACTCCAGG - Intronic
1166344260 19:42155608-42155630 TCACCCACTCCTAGCACTCCAGG - Intronic
1167535215 19:50046030-50046052 GAACACTCTCGTGGCACTTCAGG - Exonic
1168115494 19:54219810-54219832 GAACCCACCCCTGCCTCCCCTGG + Intronic
1168121293 19:54253959-54253981 GAACCCACCCCTGCCTCCCCTGG + Intronic
1168124804 19:54277491-54277513 GAACCCACCCCTGCCTCCCCGGG + Intronic
1168132836 19:54332118-54332140 GAACCCACCCCTGCCTCCCCTGG + Intergenic
1168177181 19:54634058-54634080 GAACCCACCCCTGCCTCCCCTGG - Intronic
926710390 2:15874910-15874932 TCTCCCACTCCTGGCACTCCAGG - Intergenic
928136024 2:28688020-28688042 AAAACCACCCCTGGCCCTCCAGG - Intergenic
929494165 2:42425033-42425055 AAACCCCCTCCTGGCGCTGCGGG + Intronic
929824203 2:45297454-45297476 GATACCACCCCTGCCACTCCAGG - Intergenic
931312608 2:61096407-61096429 AAACCAACTCCTGGGACTCAGGG + Intronic
932993457 2:76817181-76817203 GCATGCACTCCTGGCACTCATGG - Intronic
938081749 2:128373935-128373957 GAACCCTCTCCTGGTCCTCCTGG + Intergenic
938400535 2:130987297-130987319 GAACCAACTCCAGACACACCAGG - Intronic
938707318 2:133943740-133943762 GTACCCAGTCCTTGCCCTCCAGG - Intergenic
940161299 2:150716640-150716662 GCACATACTCCTGTCACTCCAGG - Intergenic
942114323 2:172713087-172713109 CTACCCACTCCAGGTACTCCAGG - Intergenic
944857224 2:203779618-203779640 GAACCAACTCCAGACACACCAGG - Intergenic
946982623 2:225234236-225234258 GAACTCATATCTGGCACTCCAGG - Intergenic
947711332 2:232318100-232318122 GAACCCACTCCTGCAAGGCCAGG + Intronic
947860863 2:233356103-233356125 GAAACCACTCCTGCCTCCCCAGG - Intronic
1168804004 20:662327-662349 GAACCTTCCCCTGCCACTCCAGG - Exonic
1169441052 20:5634191-5634213 AAACACACTCCTGTCACTTCCGG - Intergenic
1172764091 20:37341839-37341861 GAAGCCACGCCTGGCACTCAGGG + Intergenic
1172846192 20:37931132-37931154 GAACCCTCCCCTGGGACCCCAGG - Intronic
1175246332 20:57584442-57584464 AGACCCACACCTGTCACTCCAGG - Intergenic
1175465831 20:59191071-59191093 GCTCCCACTCCTGGCCCTCCAGG + Exonic
1175856383 20:62122906-62122928 GAACCCACCCAGGGCACACCCGG + Intronic
1180083436 21:45497080-45497102 GGACCCTCACCTGGCAATCCTGG - Exonic
1181459421 22:23077579-23077601 GACCCCACTCCTGCAACACCTGG - Intronic
1181966130 22:26657753-26657775 GAACCCAGCCCTGGGACTCTGGG - Intergenic
1182105821 22:27688362-27688384 CAACCCACTGCTGGCATTTCTGG - Intergenic
1184524177 22:45011989-45012011 GTACCCACTCCTCCCACTTCTGG + Intergenic
1184923892 22:47624343-47624365 GGGCCCACTCCTGGCGCCCCAGG + Intergenic
949149084 3:742657-742679 GAACCCACTACTGACACAGCAGG - Intergenic
951463759 3:22979056-22979078 TAACCACCTCCTGGCACTCTTGG - Intergenic
951581452 3:24168892-24168914 GAAGCCATCCCTGGCACTCTAGG - Intronic
953131571 3:40144373-40144395 GATACCACTCCTGGCACTAGTGG - Intronic
954322119 3:49839410-49839432 GCACGCACTCCTGGCACTAAGGG + Intronic
954348712 3:50024398-50024420 GAAGCCCCTCCTGCCCCTCCTGG + Intronic
954388643 3:50257762-50257784 GAACCCCCTGCTGGGGCTCCAGG - Intronic
959062948 3:101632639-101632661 GAACTCACTCCTGGCTCCCCTGG + Intergenic
960373897 3:116874803-116874825 GAACCCAGAACTGGAACTCCTGG - Intronic
960869212 3:122232349-122232371 GAAGCCCCTCCTGGTTCTCCAGG - Intronic
961520433 3:127464589-127464611 GCACACACTCTTGGCTCTCCAGG - Intergenic
961773066 3:129264311-129264333 GAAACCACTCCTAGAGCTCCTGG - Intronic
962230801 3:133663777-133663799 GAGCCCATTCCTGGCATTTCTGG + Intergenic
974385776 4:61201081-61201103 GAAGCCACCCCTGGCCCTCGCGG + Intergenic
976596358 4:86898732-86898754 GCACCACCTCCTGGAACTCCTGG - Intronic
978224318 4:106316070-106316092 GAGGCCACTCCTGGAACGCCGGG + Intronic
978423543 4:108559347-108559369 GAAAACAGTCCTGACACTCCAGG - Intergenic
982223374 4:153143373-153143395 GAAACCACTCCAGGCACTTGGGG + Intergenic
982839065 4:160159695-160159717 GAAGCCACTCGTGGCACACTTGG - Intergenic
983436763 4:167725147-167725169 GCCCCCACTTCTGGCACTCAGGG + Intergenic
983891515 4:173034714-173034736 GGCCCCACCCCTGGCACTCCAGG + Intronic
984916530 4:184730117-184730139 GAATCCATTCCAGGCACTCTGGG + Intronic
986211775 5:5680242-5680264 GAACTCACTCCTTGCACTATTGG + Intergenic
986265618 5:6187661-6187683 CAACCCACTGCTGGCACACAAGG + Intergenic
987046770 5:14116066-14116088 AATCCCACCCCTGGCTCTCCTGG - Intergenic
987821272 5:22970048-22970070 GATCCCCATCTTGGCACTCCTGG + Intergenic
991130896 5:63121294-63121316 GCCCCCACTCCCTGCACTCCAGG - Intergenic
995234059 5:109806042-109806064 TACCCCATTCCTGGCACTGCAGG + Intronic
997035486 5:130185778-130185800 GAACTCTCTCCTGACAGTCCAGG + Exonic
997727246 5:136132279-136132301 AGTCCCACTCCTGGAACTCCAGG + Intergenic
999756600 5:154669195-154669217 GATCCCATTGCTGGCCCTCCTGG - Intergenic
1001686315 5:173597381-173597403 GCAACAACTCCTGGTACTCCTGG + Intergenic
1001981449 5:176040543-176040565 GATCCCACTCCTGGAACCTCAGG - Intergenic
1003515006 6:6810444-6810466 GCCCCCACCCCTGGCACTTCTGG - Intergenic
1007533586 6:42564456-42564478 GAACCGACTCCTGGACGTCCTGG + Intronic
1009241618 6:61192830-61192852 GAAGCCACTTGTGGTACTCCTGG - Intergenic
1009631213 6:66203076-66203098 GAAGCCACTCGTGGCATGCCTGG + Intergenic
1015191278 6:130475172-130475194 GAACCCACTGCTGTGTCTCCTGG + Intergenic
1017781174 6:157716462-157716484 GAGCCCAGCCCTGCCACTCCAGG - Intronic
1018101095 6:160441170-160441192 GGACCATCTCCTGCCACTCCCGG - Intronic
1019652016 7:2164970-2164992 GAGCCCTTTCCTGGCCCTCCCGG - Intronic
1021576280 7:22108817-22108839 GAGGCCACACCTGGCACACCTGG + Intergenic
1021587867 7:22228928-22228950 TAAAACACTCCTGGCAATCCCGG - Intronic
1023843733 7:44109916-44109938 GAGCCCACTCCCGGCACATCGGG - Intronic
1023860078 7:44213292-44213314 GCACCCACTCCTGGTGCTCAAGG - Exonic
1026362806 7:69618299-69618321 CAACCCACTTCTGTGACTCCAGG + Intronic
1026543302 7:71299587-71299609 GAACACAGTCCTGGCCCTCGTGG + Intronic
1026584999 7:71648878-71648900 GAACCCAGTGCTGTGACTCCAGG + Intronic
1028968553 7:96830133-96830155 GAACCACCTCCTGGCACAACGGG - Intergenic
1030112958 7:106042092-106042114 GAATCTACTCCTGGCACACAGGG - Intergenic
1032487603 7:132299723-132299745 GAACCCACTCCTTGCTTCCCAGG + Intronic
1034699036 7:153080847-153080869 GAACTGACACCTGCCACTCCTGG + Intergenic
1036779249 8:11634433-11634455 GAACACGATCCAGGCACTCCAGG + Intergenic
1036784485 8:11677066-11677088 GAGTCCCCTCCTGGCCCTCCTGG + Intronic
1049044325 8:140137320-140137342 GGCCCCACACCTGGCACTCAAGG + Intronic
1050308646 9:4330843-4330865 TAACCCACTCCTGGCTCGCCTGG - Intronic
1050394715 9:5183721-5183743 GAAGGCTCTCCTTGCACTCCTGG + Intronic
1052112568 9:24605739-24605761 GAACCCACTCTTGACATTCCTGG - Intergenic
1055951177 9:81731123-81731145 GAACCAACTCCAGACACACCAGG + Intergenic
1056792165 9:89633034-89633056 GAACCACTTCCTGGCCCTCCAGG - Intergenic
1058168738 9:101652508-101652530 GGACCTACTACTGGCTCTCCTGG - Intronic
1059402413 9:114078478-114078500 GAGCCCAATCCTGGTGCTCCAGG - Intergenic
1059611245 9:115898885-115898907 GAACCCACTCCCTGCCCTACAGG + Intergenic
1060521463 9:124296396-124296418 GAACCCACTCCTGGCCTTGGAGG - Intronic
1062265123 9:135683464-135683486 GGACCCACTCCTGGGACAGCAGG + Intergenic
1062494040 9:136823203-136823225 GAGCCCACCCCTGGGACCCCTGG - Intronic
1186510156 X:10124601-10124623 GAACCAACTCCTGGCAGACACGG - Intronic
1188285034 X:28316186-28316208 GAACCAATTCCTGGGTCTCCAGG - Intergenic
1190325433 X:49204439-49204461 GAACCCACTCAGGGCCCACCTGG - Intergenic
1191148173 X:57190655-57190677 CCACCCGCTCCTTGCACTCCCGG + Intergenic
1191841868 X:65519074-65519096 GAACCTACTGCAGGCACTGCGGG + Intronic
1191859751 X:65656687-65656709 GAACCTACTGCAGGCACTGCGGG + Intronic
1201231252 Y:11866947-11866969 AATCACACTCCTGGCTCTCCTGG + Intergenic
1201909520 Y:19120087-19120109 TAACCCACTCCTGGCACAGAGGG - Intergenic
1201991128 Y:20027547-20027569 GAACCCAGTCCTGGAAATCATGG + Intergenic