ID: 1130537867

View in Genome Browser
Species Human (GRCh38)
Location 15:84799825-84799847
Sequence CAGTACCTGCAGAAGCACAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 1, 2: 3, 3: 38, 4: 308}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130537867_1130537869 5 Left 1130537867 15:84799825-84799847 CCGCTGTGCTTCTGCAGGTACTG 0: 1
1: 1
2: 3
3: 38
4: 308
Right 1130537869 15:84799853-84799875 AGGACAGCCCCAGCTTTCCTCGG 0: 1
1: 1
2: 2
3: 34
4: 289
1130537867_1130537873 18 Left 1130537867 15:84799825-84799847 CCGCTGTGCTTCTGCAGGTACTG 0: 1
1: 1
2: 3
3: 38
4: 308
Right 1130537873 15:84799866-84799888 CTTTCCTCGGCCCTCCCTTCTGG 0: 1
1: 0
2: 1
3: 24
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130537867 Original CRISPR CAGTACCTGCAGAAGCACAG CGG (reversed) Exonic
900002898 1:24753-24775 CAGTACCTGCAGAAGGTCTCTGG - Intergenic
900022618 1:195278-195300 CAGTACCTGCAGAAGGTCTCTGG - Intergenic
901325901 1:8364936-8364958 CAGAACCTGCAGTAGGCCAGAGG - Intronic
901877075 1:12172950-12172972 CAGAACCTTCAGCAGCACAGAGG - Intronic
903656304 1:24950672-24950694 GGGTACCTGGACAAGCACAGGGG + Intronic
903699713 1:25237969-25237991 CAGTACCTACATAAGATCAGAGG + Intergenic
904021514 1:27470102-27470124 CAGTGTCAGCAGAAGCACAAAGG + Intronic
904600762 1:31671456-31671478 CAGTCCCTGCAGATGCTCTGCGG + Intronic
904714659 1:32458235-32458257 CAGAACCTGGAGATGCAGAGGGG + Intergenic
905343821 1:37297972-37297994 CAGTAACTGCAGGAGCCCAGGGG + Intergenic
906051436 1:42877585-42877607 TAGCAGCTGCAGAGGCACAGTGG + Intergenic
906674313 1:47682213-47682235 CAGTAAGTGCAAAGGCACAGAGG - Intergenic
907012854 1:50978911-50978933 CAGCACCTGCAGAAGCACAGTGG + Intergenic
907377759 1:54057884-54057906 CAGTATATGCAAAGGCACAGAGG - Intronic
907659218 1:56376686-56376708 CTGTTCCTGCAGATGCAGAGAGG + Intergenic
907974263 1:59415623-59415645 CAGGAGCTGCAGGAGCTCAGAGG - Intronic
908090276 1:60678311-60678333 CAGCATTTGCAGAAGCCCAGAGG + Intergenic
908759923 1:67502254-67502276 TAGTTCCTGCAGAGACACAGAGG + Intergenic
908844271 1:68308893-68308915 CAGTGCCAGCAGATACACAGTGG - Intergenic
908963460 1:69729627-69729649 CTGTACCTGCAAAGCCACAGGGG - Intronic
909459870 1:75898437-75898459 CAGAACCTGAAGAAAAACAGAGG - Intronic
910666784 1:89734134-89734156 CAGTACCTGGAAAAGGAGAGAGG + Intronic
911280136 1:95914839-95914861 CACTACTTACAGAAGAACAGAGG + Intergenic
912883183 1:113439366-113439388 CAGTATGTGCAAAGGCACAGAGG - Intronic
913044028 1:115058123-115058145 CAGGACCTGAAGCAGCACACAGG - Intronic
913529257 1:119721892-119721914 CTGTTTCTGCAGAAACACAGGGG + Intronic
915351676 1:155230791-155230813 CAGTGGCTGAAGAAACACAGGGG + Intergenic
915538238 1:156550590-156550612 CAGCACCTCCAGAACCACAGAGG + Intronic
915739106 1:158104602-158104624 TGGTGCCTGCAGAAGCTCAGGGG - Intergenic
918187283 1:182139390-182139412 CAGTACGTGCAGGGGCACAAAGG + Intergenic
923386950 1:233474099-233474121 AAGTACCCGCAGTAGGACAGAGG + Intergenic
924374450 1:243390699-243390721 CATTTCCTGAAGAAGCCCAGAGG + Intronic
924472006 1:244350749-244350771 AAGTAACTGAAGAATCACAGAGG + Intergenic
1063047568 10:2408666-2408688 CATTGCCCGCAGAAGCACTGTGG + Intergenic
1063299728 10:4840686-4840708 CAGTATTTGCAAAGGCACAGAGG - Intronic
1064534189 10:16341882-16341904 CAGCATCTGGAGCAGCACAGGGG + Intergenic
1066354604 10:34670206-34670228 AAGCACCTGCAGCTGCACAGAGG - Intronic
1069546177 10:69330499-69330521 CAGTACCTGCAGAACCAGAACGG + Intronic
1069901798 10:71710707-71710729 CAGTACATGAAGAAGCAGGGAGG + Intronic
1071330273 10:84551992-84552014 CAGGACACGCAGAAGCTCAGAGG + Intergenic
1071664211 10:87538047-87538069 CAGTGACTCCAGAAGCAGAGGGG - Intronic
1071753030 10:88502973-88502995 CAGTACCTGGGGAATCACAGTGG - Intronic
1072708043 10:97696314-97696336 CTGTTCCTGCAGAAGCATAATGG - Intergenic
1074562075 10:114543815-114543837 CAATACCTGCAGAGGCTCAGAGG - Intronic
1074825726 10:117214609-117214631 CAGCATCTTCAGAAACACAGAGG + Intergenic
1074878788 10:117635167-117635189 CAGCACCTACACAAACACAGAGG - Intergenic
1075059864 10:119248650-119248672 CAGGCCCTACAGAAACACAGCGG - Intronic
1077675269 11:4189376-4189398 CTGTACCTTCAGGAACACAGCGG - Intergenic
1078107448 11:8367435-8367457 CAGTACCTAAAGAAGCAGAGAGG - Intergenic
1078274312 11:9828172-9828194 CACTACCTGCTTAAGCACAGTGG + Intronic
1080946267 11:36978715-36978737 CAAGCCCTGCAGAACCACAGGGG - Intergenic
1082883253 11:58058754-58058776 CAGCAGCTGCAGAAGCAGATCGG - Intronic
1083642933 11:64155211-64155233 CAGTATGTGCAAAAGCCCAGAGG + Intronic
1084310984 11:68316142-68316164 CAGAACAGGCAGAACCACAGAGG - Intronic
1084685640 11:70693390-70693412 CAGCAAGTGCAGAAGCACTGGGG - Intronic
1085461379 11:76695932-76695954 CAGCAGGTGCAGAGGCACAGAGG + Intergenic
1085671203 11:78465961-78465983 AAGTACCTGGTGAAGCACTGTGG - Exonic
1085735045 11:79031656-79031678 CTGTACCTGTGGAAGGACAGTGG + Intronic
1086052235 11:82606866-82606888 CAGTATGTACAGGAGCACAGAGG + Intergenic
1086787354 11:90985834-90985856 TAATATCTGCAGAAGCACAGAGG - Intergenic
1091376316 12:26816-26838 CAGTACCTGCAGAAGGTCTCTGG - Intergenic
1093498086 12:19780058-19780080 CTGTAGCTGCAGAGGCAGAGGGG + Intergenic
1094443871 12:30508639-30508661 CAGCACCTGCAGAAGGCCACAGG + Intergenic
1096640506 12:52990630-52990652 CAATTCCTGAAGCAGCACAGAGG + Intergenic
1096896076 12:54821715-54821737 CAGTTCCTGGAGGAGCACTGTGG + Intergenic
1097053574 12:56237628-56237650 CAGCCCCTGCAGGAGCACATGGG - Exonic
1097688050 12:62709467-62709489 CTGTGCCAGCAGAAGCCCAGAGG - Intronic
1098743110 12:74200317-74200339 CTGTACCTGCAAAGCCACAGGGG - Intergenic
1100448045 12:94679082-94679104 CATAACCTGCAAAAGCACAAAGG - Intergenic
1102571181 12:113827857-113827879 CAGTAACTGCAGAAACTGAGAGG - Intronic
1103939345 12:124493334-124493356 CTGTACCTGCAGCTGCCCAGAGG - Intronic
1104268577 12:127261500-127261522 CAGAACCTGCAGAGGCACAGGGG - Intergenic
1104673509 12:130696876-130696898 CAGCTTCTGCAAAAGCACAGAGG + Intronic
1104720850 12:131044399-131044421 CAGGAGAGGCAGAAGCACAGGGG + Intronic
1105738378 13:23295955-23295977 CAGTCAGTGCAAAAGCACAGAGG - Intronic
1105811549 13:24000639-24000661 CAGGACATGCAGAAGCCCTGTGG + Intronic
1106580892 13:31017310-31017332 CAGCATGTGCAAAAGCACAGAGG + Intergenic
1107495420 13:40921618-40921640 CAGGACCTGCAGCATCCCAGAGG - Intergenic
1107961544 13:45563646-45563668 CAGTACATGCAGAAGGGGAGAGG + Intronic
1109748335 13:66656209-66656231 CAGTATATGCACAAGCACTGTGG + Intronic
1111568443 13:90047543-90047565 CATATCCTGCAGAAACACAGGGG - Intergenic
1113741726 13:112716129-112716151 CAGCATCTGCAGAAGGCCAGAGG - Intronic
1113751487 13:112779444-112779466 CTGTCCCAGCTGAAGCACAGCGG - Intronic
1113874772 13:113587277-113587299 CAGGAACTGCATAGGCACAGGGG + Intronic
1113913622 13:113856829-113856851 CCGTCCCTGCAGAAGCAGAGAGG - Intronic
1114453636 14:22842087-22842109 GAGTCCCTGCATAAGCACAATGG - Intronic
1114931930 14:27482271-27482293 CAGTTTCAGCAAAAGCACAGAGG + Intergenic
1115289202 14:31751582-31751604 CTGTACCTGCAAAGCCACAGGGG - Intronic
1115754285 14:36517693-36517715 CAGCAACTGCAGCAGGACAGCGG - Exonic
1115890194 14:38017888-38017910 CAGCACCTTCAGAACTACAGGGG - Intronic
1117186725 14:53247291-53247313 CAGTATATGCAAAAGCACGGAGG + Intergenic
1117606982 14:57440159-57440181 AGGTACCTGCTGAACCACAGTGG - Intergenic
1118688045 14:68311341-68311363 CAGTGGCTGCAGAAACACGGTGG - Intronic
1119526072 14:75323449-75323471 CAGTAGGTGCAGAAGCCCTGAGG - Intergenic
1120377536 14:83729283-83729305 CTGTACCTGCAGAGCCACAGAGG - Intergenic
1121693543 14:95894621-95894643 CAGCACCTGCAGAAGGTCATGGG - Intergenic
1122322411 14:100863093-100863115 CAGTGTCTGAAGAAGCTCAGAGG + Intergenic
1122481526 14:102050418-102050440 GGTTACCTGCAGAAGCAGAGGGG - Exonic
1122935417 14:104953798-104953820 CCACACATGCAGAAGCACAGGGG - Exonic
1123187261 14:106531613-106531635 CAGGACCTGCAGGAGAAGAGGGG + Intergenic
1123721375 15:23064553-23064575 CAGCAGCTGCAGCAGCACAGTGG - Intergenic
1123857346 15:24426926-24426948 CACCACCTGCAAAAGCACTGAGG - Intergenic
1124457335 15:29856264-29856286 CAATACCTGTAGAAGTAAAGAGG - Intronic
1125087999 15:35753758-35753780 CAGTACCATGAGAAGCAGAGAGG - Intergenic
1128292505 15:66488723-66488745 CAGCACCTGCAGAAGCAAACCGG - Intronic
1129556114 15:76511619-76511641 CAGTTTATGCAAAAGCACAGAGG - Intronic
1129725415 15:77899163-77899185 CTGCACCTCCAGCAGCACAGTGG - Intergenic
1130537867 15:84799825-84799847 CAGTACCTGCAGAAGCACAGCGG - Exonic
1131152997 15:90058574-90058596 CAGTGACTGCAGAGGAACAGAGG - Intronic
1131478438 15:92761692-92761714 CAGTAGCAGCAGAAGCCTAGTGG + Intronic
1132234091 15:100206172-100206194 GAGTACATGCAGAGGCCCAGAGG - Intronic
1132450612 15:101966186-101966208 CAGTACCTGCAGAAGGTCTCTGG + Intergenic
1132781919 16:1631594-1631616 CAGTGCCTGAAGCAGCACTGAGG + Intronic
1133023861 16:2979381-2979403 CAGTACCTGAGGGAGTACAGGGG + Intronic
1133721447 16:8498239-8498261 CATGATCTGCAGAAGCAGAGCGG - Intergenic
1134054522 16:11161282-11161304 GAGCTGCTGCAGAAGCACAGGGG + Intronic
1134812555 16:17180104-17180126 TAGCACCTGCAGAAACTCAGTGG + Intronic
1135271691 16:21075110-21075132 CAGTCCCGTCAGAAGCACAGGGG - Intronic
1136095466 16:27952484-27952506 CAGCACATGCAAAGGCACAGAGG + Intronic
1137581500 16:49636291-49636313 GAGCACCTGCAGACGCACCGGGG - Exonic
1137820198 16:51436786-51436808 CAGTCCCTGCAAGGGCACAGGGG + Intergenic
1138280665 16:55770271-55770293 CAGCACATGCAAAAGCTCAGAGG - Intergenic
1138287821 16:55823352-55823374 CAGCACATGCAAAAGCTCAGAGG + Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1143782537 17:9236808-9236830 CAGTGCCTGGAGAAGCACAGGGG + Intronic
1145274050 17:21419631-21419653 CAGCACCAGCAGAGGCTCAGGGG - Exonic
1145311913 17:21705530-21705552 CAGCACCAGCAGAGGCTCAGGGG - Intergenic
1146706506 17:35004256-35004278 CAATACCTGCAAATGCAGAGGGG - Exonic
1147750064 17:42725796-42725818 TAGTACATGGAGAAGCAAAGTGG + Intronic
1148255603 17:46128910-46128932 CAGTAACTTCAGAAGCAAGGAGG + Intronic
1151209614 17:72534682-72534704 CAGCATATGCAGAGGCACAGAGG - Intergenic
1151293142 17:73164894-73164916 CGGGTCCTGCAGAAGGACAGGGG - Intergenic
1151620963 17:75244712-75244734 CAGCACCTGTAGCCGCACAGAGG + Exonic
1151636358 17:75351255-75351277 CTGTTCCTACAGAAGTACAGAGG - Intronic
1153913308 18:9722725-9722747 CAGTCCCTGGATAATCACAGTGG - Intronic
1154177046 18:12092612-12092634 CAGTGCATGCAGCAGCTCAGAGG + Intergenic
1155779388 18:29811786-29811808 CAGCAGCAGCAGTAGCACAGTGG - Intergenic
1155840052 18:30632560-30632582 CAGCAGCTGCAGGTGCACAGTGG - Intergenic
1156294067 18:35774106-35774128 CAGAAGCTGCAGCAGCAGAGGGG - Intergenic
1157488288 18:48105020-48105042 CATCCCCTGCAGAACCACAGAGG - Intronic
1157565061 18:48674337-48674359 CAGGAGCTGCAGCAGCACAGGGG - Intronic
1159261273 18:66016107-66016129 CTGTACCTGCAAAGCCACAGGGG - Intergenic
1160137624 18:76286046-76286068 CCCTCCCTGCAGAAGCACAAAGG + Intergenic
1160634649 19:66361-66383 CAGTACCTGCAGAAGGTCTCTGG - Intergenic
1160732827 19:649047-649069 CAGGACCTGCAAAAGCACCGAGG + Intronic
1160783449 19:888885-888907 CAGCACAAGCAGACGCACAGAGG + Intronic
1160866990 19:1260464-1260486 AAGCACCTGCTGAATCACAGGGG + Intronic
1162065585 19:8123527-8123549 CGGTACCTGCAGAAACACGGTGG - Exonic
1162337890 19:10072932-10072954 CCATCCCTGCAGAAGCCCAGTGG + Intergenic
1162596558 19:11633925-11633947 CTGTACCTGCAAAGCCACAGGGG + Intergenic
1163678677 19:18668502-18668524 CAGCACCTGCAGTACCGCAGCGG + Exonic
1163784170 19:19266152-19266174 CAGCACAAGGAGAAGCACAGAGG - Intronic
1163798028 19:19348443-19348465 CTCTAGCTGCAGAGGCACAGGGG - Intronic
1165601451 19:37058417-37058439 CAGTCCATCCAGAAGCAGAGGGG - Intronic
1166532627 19:43552220-43552242 CAGTCCCTGCCCGAGCACAGGGG - Exonic
1168250400 19:55138197-55138219 CAGAACCAGCAGAAACGCAGGGG + Intronic
1168571415 19:57474157-57474179 CAGCACCAGAAGCAGCACAGTGG - Exonic
1168700326 19:58434947-58434969 CAGCACCAGAAGGAGCACAGTGG - Exonic
926268926 2:11350363-11350385 CAGCACCAGCAAAGGCACAGAGG - Intergenic
926914043 2:17876762-17876784 CAGCTCCTGCAGATGCACAGGGG + Intergenic
929611949 2:43277221-43277243 CATTACCTGCAGAAGGAGATCGG + Intronic
930462607 2:51702420-51702442 CAGGAGCTGAAGAAACACAGAGG - Intergenic
931254026 2:60554794-60554816 GAGCAACTGCAAAAGCACAGAGG + Intergenic
932112240 2:69012241-69012263 CAGTACATGCATATGCACTGAGG + Intergenic
932982705 2:76689130-76689152 CATTACCTGCAGAATTTCAGTGG - Intergenic
933264428 2:80166978-80167000 CAGGATCTGTAGAAGGACAGTGG - Intronic
935418272 2:102841319-102841341 CGTCCCCTGCAGAAGCACAGGGG + Intronic
935697300 2:105781297-105781319 CAGGACCTGCAAAGGCACAGAGG - Intronic
935857273 2:107288669-107288691 CACTACCTGGAGCAGCACTGGGG + Intergenic
936566828 2:113588666-113588688 CAGTACCTGCAGAAGGTCTCTGG + Intergenic
936913488 2:117616092-117616114 CAGTACTGGCAGAAGCAGAGTGG - Intergenic
937024073 2:118682873-118682895 CAGCAGCAGCAGCAGCACAGAGG - Intergenic
937680533 2:124639937-124639959 GAGTATCTGCAGCAGCAAAGGGG - Intronic
937963197 2:127479477-127479499 CAGCAAACGCAGAAGCACAGTGG - Intronic
939377083 2:141382334-141382356 CAGTATCTGCTGTGGCACAGAGG - Intronic
939677292 2:145088302-145088324 CTGCACGTGCAGAAGCCCAGGGG + Intergenic
939773961 2:146361305-146361327 TAGAACCCACAGAAGCACAGGGG + Intergenic
940531708 2:154886335-154886357 CAGCAGCTGCAGTAGCACAGTGG + Intergenic
940850260 2:158681760-158681782 CAGTAACTTCATAAGAACAGTGG + Intronic
941356786 2:164503880-164503902 AAAGACCTTCAGAAGCACAGAGG - Intronic
942371970 2:175294952-175294974 CAGTAGAAGCAGAAGCACACAGG - Intergenic
942712113 2:178848268-178848290 CAGTGAATGCAGAAGCACAATGG + Intronic
942769045 2:179494260-179494282 GAGTAGATGCAGAATCACAGGGG + Intronic
943248403 2:185485141-185485163 CTGTACCTGCAGAGCCACAGGGG + Intergenic
943668684 2:190637578-190637600 CAGCAAGTACAGAAGCACAGAGG - Intergenic
944968901 2:204968591-204968613 CAGTATCTGCAAAGGCACAGAGG - Intronic
946454507 2:219813305-219813327 AAGAACCTGCAGAAACACAGTGG - Intergenic
948276705 2:236714572-236714594 CAGGCCGTGAAGAAGCACAGGGG - Intergenic
1168856473 20:1012804-1012826 CAGTAAATGCAGAGGCCCAGAGG + Intergenic
1170509326 20:17060441-17060463 CAGTATGTGCAAATGCACAGAGG + Intergenic
1170871256 20:20208769-20208791 CAGAACCTGCTGACCCACAGAGG - Intronic
1170893471 20:20395054-20395076 GAGTTCCTGCAGATGGACAGAGG + Intronic
1170903220 20:20486471-20486493 CAGTAGCTGCAGAAGAGCAAGGG - Intronic
1170938609 20:20830380-20830402 CTGAACCTGCAGAGCCACAGGGG + Intergenic
1172165583 20:32897068-32897090 CAGCACATGCCGAGGCACAGAGG - Intronic
1172201447 20:33129489-33129511 CAGTACATGCAGAGGCCCTGGGG - Intergenic
1172478928 20:35259613-35259635 CAGCACTGGCAGAAGAACAGAGG + Intronic
1172648039 20:36483751-36483773 CAGGACCTGAAGGAGGACAGTGG + Intronic
1173225963 20:41162639-41162661 CAGGACCTGGAGCAGCGCAGCGG + Exonic
1174054895 20:47791675-47791697 CACTACCTGCAGGAGAGCAGGGG + Intergenic
1175582665 20:60112616-60112638 CAGCATCAGCAGCAGCACAGTGG + Intergenic
1175781886 20:61688119-61688141 GAGGCCCTGCAGAAGCTCAGAGG - Intronic
1177732307 21:25043435-25043457 CACTAACAGCAGAAGCCCAGGGG + Intergenic
1178565259 21:33678082-33678104 AAGAAACTGGAGAAGCACAGAGG - Intronic
1179887093 21:44318859-44318881 CACTGCCTACAGAAGCTCAGTGG - Intronic
1180032836 21:45224030-45224052 CTGCACCTGCAGAAGGAGAGGGG + Exonic
1181079402 22:20403954-20403976 CAGCATGTGCAGAAGCTCAGAGG - Intronic
1183410839 22:37654220-37654242 CCGTCCCTCCAGAAGCCCAGAGG + Intronic
1183741463 22:39670791-39670813 CACCACCTGCAGAGGCCCAGCGG + Exonic
1184650304 22:45916555-45916577 CAGTGCCAGGAGAAGCCCAGTGG - Intergenic
1184724728 22:46336902-46336924 CAGTGCAAGCAGAATCACAGAGG + Intronic
1184975303 22:48057558-48057580 TCGCACCTGCAGAGGCACAGAGG + Intergenic
1185380552 22:50505798-50505820 CAGGACCTGCAGCAGCACCTGGG + Exonic
950093331 3:10312760-10312782 TAGTGCCTGCAGAGGCACTGTGG - Intronic
950660031 3:14461531-14461553 CAAGCCCTGCAGACGCACAGGGG + Intronic
950787250 3:15447034-15447056 GAGATTCTGCAGAAGCACAGAGG - Intronic
953688600 3:45098051-45098073 CAGGGACTGCAGAAGCAGAGGGG - Intronic
954430338 3:50467463-50467485 CAGTAGATGGAGAAGCAAAGCGG - Intronic
956720666 3:72114875-72114897 CAGGCCCTGCAGAAGCAGAATGG - Intergenic
956773612 3:72547480-72547502 CAGTACATGCAAAAGCCCAGAGG - Intergenic
958513960 3:95088439-95088461 CATTAACTGCAGAAGCAGTGTGG - Intergenic
959563665 3:107812468-107812490 CAGTATATGCAGAAGTAGAGAGG + Intergenic
960952428 3:123008388-123008410 CGGCACCTGTAGATGCACAGTGG + Intronic
961275209 3:125720964-125720986 CAGATCCCGAAGAAGCACAGGGG - Intergenic
961376391 3:126468864-126468886 CAGGACCAGCAACAGCACAGTGG - Intronic
961504022 3:127358271-127358293 CAGTGCCAGCAGAGGAACAGAGG - Intergenic
961611961 3:128146884-128146906 CAGTCCTTACAGCAGCACAGTGG - Intronic
962065528 3:131975568-131975590 CAGGGCCTGCAGAAGCAGTGTGG - Intronic
962770021 3:138603195-138603217 CCGTACCTGCAAAGCCACAGGGG + Intergenic
964848131 3:161065913-161065935 CAGCACTTGCAAAGGCACAGAGG - Intronic
966334195 3:178850189-178850211 CAGTAAGTGCAAAAGCCCAGAGG - Intergenic
967094906 3:186169629-186169651 GAGTACATGTAAAAGCACAGAGG - Intronic
967217907 3:187225698-187225720 CAGTTCCTGAAGAAAGACAGAGG - Intronic
967659603 3:192090707-192090729 CAGCAGCTGCAGCAGCACAGTGG - Intergenic
967749911 3:193101753-193101775 CTGTACCTGCAAAGCCACAGGGG + Intergenic
968403341 4:317248-317270 CAGCATGTGCAAAAGCACAGCGG - Intergenic
968507400 4:977237-977259 GAGTAACTGCGGAAGCACGGTGG + Intronic
968732463 4:2276081-2276103 TAAACCCTGCAGAAGCACAGAGG + Intronic
968946247 4:3665951-3665973 CTGGAGCTGCAGGAGCACAGAGG + Intergenic
969220038 4:5753342-5753364 CAGGAACTGCAGAGGGACAGAGG + Intronic
971154638 4:24068332-24068354 CAGTATCTGCAGAAGCCCAGAGG + Intergenic
972205313 4:36764903-36764925 CAGCAGCTGGAGAAGCACTGTGG + Intergenic
972332890 4:38080159-38080181 CACTCCCTCCAGCAGCACAGGGG - Intronic
973004559 4:44991449-44991471 AAGTACCTCCAGAGGCTCAGTGG + Intergenic
973547346 4:51995225-51995247 TAACACATGCAGAAGCACAGAGG - Exonic
975637431 4:76464158-76464180 CATAACCTGCAGAGCCACAGGGG + Intronic
976605205 4:86976182-86976204 CTTTCCATGCAGAAGCACAGAGG + Intronic
976774992 4:88698084-88698106 CAGTTCCTGAAGAAGCACCTCGG - Exonic
977101522 4:92822294-92822316 CATTGCCTCCAGAAGCACAGAGG + Intronic
979868966 4:125792421-125792443 GAGGACCTGAAGCAGCACAGTGG + Intergenic
980492360 4:133544381-133544403 TAGTACCTGGAAAAGCAAAGAGG - Intergenic
982768310 4:159372604-159372626 AAGTACCTGAACAGGCACAGTGG + Intergenic
983538867 4:168887494-168887516 GTCTACCTGCAGAAACACAGTGG + Intronic
984003549 4:174281407-174281429 AAGTACTTGCACCAGCACAGTGG + Intronic
984365519 4:178794308-178794330 CAGCCCCTGCAGAAGCACCTGGG - Intergenic
985201480 4:187489172-187489194 CTGTACCTGCAGAGCCACAGGGG + Intergenic
985780610 5:1868975-1868997 CAGGACCTGCAGATGGGCAGAGG + Intergenic
987537409 5:19206770-19206792 AAGCACCTGCAGAGCCACAGTGG + Intergenic
988718890 5:33856184-33856206 CAGGACCTGCTGTAGCTCAGTGG + Intronic
988819479 5:34867055-34867077 CAGTACTTGCAGCAGGTCAGTGG + Exonic
988854079 5:35210105-35210127 CAGTACCTGCAAAGGCACTGAGG - Intronic
990518047 5:56549158-56549180 CAGTATCTGCAGAGGCAGAGTGG + Intronic
990714555 5:58622372-58622394 CAGTCCCTGCAGAATCAGTGAGG + Intronic
991301386 5:65132429-65132451 CAGTTCCCTCGGAAGCACAGTGG - Intergenic
992332353 5:75730284-75730306 CAGTGCCTGCATCAGCAGAGTGG - Intergenic
993041863 5:82823680-82823702 CAGTGCCTACAGAAGCGTAGGGG + Intergenic
993792497 5:92224282-92224304 CTGTACCTGCAAAGCCACAGAGG - Intergenic
994304021 5:98180558-98180580 CACTGCCTGGAGAGGCACAGTGG + Intergenic
996286181 5:121795750-121795772 AAGGACCTGCAGGAGCACAGTGG + Intergenic
997896345 5:137721083-137721105 TAGGAGCTACAGAAGCACAGGGG + Intronic
998140403 5:139696866-139696888 CAGGACCTGCAGGAGCAGAACGG + Intergenic
998544148 5:143011662-143011684 CAGCACCTGCACAAACAAAGGGG - Intronic
998895207 5:146791642-146791664 TAGCATCTGCAAAAGCACAGAGG - Intronic
999273793 5:150314718-150314740 CAGGACCTGGGGAAGAACAGAGG + Intronic
999371588 5:151058625-151058647 CAGAACTTGCAGAGGCAGAGAGG - Intronic
999593753 5:153178872-153178894 CAGAACCTACAGCAACACAGTGG - Intergenic
1000937905 5:167325462-167325484 TAGTTCCTGCAGACCCACAGAGG + Intronic
1001155421 5:169268715-169268737 CAGCACTTGCAGAACCTCAGAGG + Intronic
1001313885 5:170629472-170629494 CAAGGCCTGCAGAAGCAGAGAGG + Intronic
1001664511 5:173421392-173421414 CAGTACCAGCAGACCCAGAGAGG - Intergenic
1002717759 5:181239066-181239088 CCTTGCCTCCAGAAGCACAGAGG + Exonic
1003526975 6:6906232-6906254 CAGTCCCTGGAGAACCACAAGGG - Intergenic
1004340620 6:14804658-14804680 CAAACCCTGCAGAGGCACAGGGG + Intergenic
1006564863 6:34946746-34946768 CTGTACCTGCATATGCACAAAGG + Intronic
1008192492 6:48476404-48476426 GAGTTCCTGCAGCATCACAGAGG - Intergenic
1012668917 6:102015650-102015672 CAGTAGCAGCAGCAGCACGGTGG - Intronic
1018592603 6:165443428-165443450 CATACCCTGCAGAACCACAGGGG - Intronic
1018914493 6:168124901-168124923 CACGAACTGCAGAAGCAAAGGGG + Intergenic
1019528149 7:1490169-1490191 CAGCACCTGCCGAAGGAGAGAGG + Intronic
1020962124 7:14818480-14818502 GGGTACCTGCAGAAGTATAGTGG - Intronic
1021400429 7:20203912-20203934 CAGTACCTTCATAAGCAATGTGG + Intronic
1022255991 7:28658524-28658546 CAGTCCCTGCAGCTGCACTGGGG + Intronic
1022329480 7:29363846-29363868 CAGTAACTGCAAAAGCCCTGAGG + Intronic
1022577815 7:31515640-31515662 CAGTACGTGAAAAAGCCCAGAGG + Intronic
1023999867 7:45183140-45183162 TAGTACCTGCAAAAGCAGAGGGG - Exonic
1025238094 7:57248463-57248485 CACTACCTGCAGAAGAGCAGGGG - Intergenic
1029537419 7:101164574-101164596 GAGTGCCTGCAGCAGCACCGCGG + Exonic
1029681620 7:102115360-102115382 GTGTCCCTGCAGCAGCACAGAGG - Intronic
1031318798 7:120293824-120293846 CATTATCTGTAGAAGCACATAGG + Intronic
1032067596 7:128783305-128783327 CAATGCCTGCTGGAGCACAGTGG + Intergenic
1032528063 7:132594790-132594812 CAGTGCCTGAAGAAGCAGACTGG - Intronic
1033145839 7:138869439-138869461 CAGGCCCTGCAGTAGCAGAGGGG + Intronic
1033518027 7:142129022-142129044 CTGTACATGCAGAGCCACAGAGG + Intronic
1033581848 7:142745284-142745306 CAGAACCTGCTCAAACACAGTGG + Intergenic
1035054623 7:156026252-156026274 CAGTTCCTAGAGAAGTACAGAGG + Intergenic
1035064663 7:156095941-156095963 GACTGCCTGCAGAGGCACAGGGG - Intergenic
1035467338 7:159088215-159088237 CAGCATCTGCAGCAGCACACTGG + Intronic
1036583495 8:10100402-10100424 CAGGACCTCCACAAGCACAATGG - Intronic
1039128516 8:34232350-34232372 CAGTATCTGCATCAGCACACTGG + Intergenic
1039854090 8:41397810-41397832 CTGTTCCTGGGGAAGCACAGAGG - Intergenic
1040917826 8:52581672-52581694 AAGTAACTTGAGAAGCACAGAGG + Intergenic
1042651399 8:71045888-71045910 CAGTAGCTGCAGAAGGAAAGAGG + Intergenic
1042795324 8:72656055-72656077 CAGTGCATGCCAAAGCACAGAGG + Intronic
1043426163 8:80150555-80150577 CTGTACCTGCAAAGCCACAGGGG + Intronic
1044127328 8:88474432-88474454 CTGTACCAGCAGAAGCAAGGTGG + Intergenic
1044337719 8:91007195-91007217 CTGTACATGGAGAAGCAAAGTGG - Intronic
1045036127 8:98177926-98177948 CAGTTCGTGCAGAAGCCCTGCGG + Intergenic
1045577050 8:103434465-103434487 CAGTTCCTGCCTAAGAACAGTGG - Intronic
1046300099 8:112276263-112276285 CTGTACCTGCAAAGCCACAGGGG - Intronic
1046785276 8:118259120-118259142 CAGGACCTACAGAAGCATAGTGG + Intronic
1048912871 8:139152854-139152876 CAGAAACAGCAGCAGCACAGAGG - Intergenic
1049156930 8:141073023-141073045 CAGCACCTGCAGGGGCCCAGAGG - Intergenic
1049207044 8:141368427-141368449 GAGTATCAGCAGAAGCACACGGG - Intergenic
1049885703 9:24866-24888 CAGTACCTGCAGAAGGTCTCTGG - Intergenic
1052705354 9:31988304-31988326 CTGTACCTGCAAAGCCACAGGGG - Intergenic
1052900562 9:33791248-33791270 CAGAACCTGCTCAAACACAGTGG + Intronic
1055416535 9:76090351-76090373 CATTTCCTACAGAGGCACAGGGG - Intronic
1057270453 9:93647381-93647403 CTGTCCCTGCAGAAGCAGGGAGG + Intronic
1057415886 9:94861828-94861850 CAGGTCCTACAGAAGCACGGAGG - Intronic
1057686427 9:97238546-97238568 CAGGACCTGCAGCATCCCAGAGG + Intergenic
1058186671 9:101863584-101863606 CAGCACAAGCAGAAGCATAGAGG - Intergenic
1059355435 9:113695990-113696012 CAGTACCTGCAGTTGCTCAAAGG + Intergenic
1059500216 9:114746068-114746090 CAGCACTTTCAGAAGCACAGAGG + Intergenic
1060528650 9:124334709-124334731 CAGCACGTGCAAAGGCACAGAGG + Intronic
1062087491 9:134656287-134656309 CAGGCTCTGCAGAAGGACAGAGG - Intronic
1062255561 9:135619169-135619191 CAGGACCTGGAGACGCACAGAGG - Intergenic
1185919154 X:4069958-4069980 CAGGAACTGCAGCAGCACATAGG + Intergenic
1186360721 X:8838029-8838051 CAGCACCTGCAAAAACCCAGAGG - Intergenic
1187577592 X:20574903-20574925 CAGTAAGTGCAAAAGCTCAGCGG + Intergenic
1189354914 X:40303339-40303361 CACTAAGTGAAGAAGCACAGAGG + Intergenic
1190763756 X:53459029-53459051 CAGTACCTGCAGAGAGACACAGG + Intergenic
1190912683 X:54787248-54787270 CAGCATGTGCAGAGGCACAGAGG - Intronic
1191104489 X:56764156-56764178 CAGTACCTGGAGATGACCAGGGG - Intergenic
1192797005 X:74432207-74432229 CGTTACCTGCAGGAGAACAGAGG - Intronic
1195837676 X:109136844-109136866 AAGAACCTGCAGCAACACAGTGG - Intergenic
1195861503 X:109388306-109388328 CAGTACCTGCACTAACACAGTGG - Intronic
1197567114 X:128101364-128101386 CTGTACCTGCAAAGCCACAGGGG - Intergenic
1198471416 X:136950433-136950455 AAAAACATGCAGAAGCACAGAGG - Intergenic
1198792849 X:140364553-140364575 AAGAACCTGAAGAAACACAGTGG + Intergenic
1201858896 Y:18573713-18573735 CAGCACCTGCAGAGGTACTGAGG - Intronic
1201874426 Y:18746668-18746690 CAGCACCTGCAGAGGTACTGAGG + Intronic