ID: 1130538639

View in Genome Browser
Species Human (GRCh38)
Location 15:84804583-84804605
Sequence GTTAGTAATTCCCATCCAAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 81}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130538634_1130538639 13 Left 1130538634 15:84804547-84804569 CCCTTAACCTCACTGTCTCCTCT 0: 1
1: 0
2: 8
3: 43
4: 490
Right 1130538639 15:84804583-84804605 GTTAGTAATTCCCATCCAACTGG 0: 1
1: 0
2: 0
3: 5
4: 81
1130538638_1130538639 -10 Left 1130538638 15:84804570-84804592 CCTTCACAATAGAGTTAGTAATT 0: 1
1: 0
2: 1
3: 18
4: 170
Right 1130538639 15:84804583-84804605 GTTAGTAATTCCCATCCAACTGG 0: 1
1: 0
2: 0
3: 5
4: 81
1130538635_1130538639 12 Left 1130538635 15:84804548-84804570 CCTTAACCTCACTGTCTCCTCTC 0: 1
1: 0
2: 10
3: 48
4: 505
Right 1130538639 15:84804583-84804605 GTTAGTAATTCCCATCCAACTGG 0: 1
1: 0
2: 0
3: 5
4: 81
1130538633_1130538639 29 Left 1130538633 15:84804531-84804553 CCAGCTCTTAACAAATCCCTTAA 0: 1
1: 0
2: 2
3: 15
4: 126
Right 1130538639 15:84804583-84804605 GTTAGTAATTCCCATCCAACTGG 0: 1
1: 0
2: 0
3: 5
4: 81
1130538637_1130538639 -5 Left 1130538637 15:84804565-84804587 CCTCTCCTTCACAATAGAGTTAG 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1130538639 15:84804583-84804605 GTTAGTAATTCCCATCCAACTGG 0: 1
1: 0
2: 0
3: 5
4: 81
1130538636_1130538639 6 Left 1130538636 15:84804554-84804576 CCTCACTGTCTCCTCTCCTTCAC 0: 1
1: 0
2: 9
3: 102
4: 850
Right 1130538639 15:84804583-84804605 GTTAGTAATTCCCATCCAACTGG 0: 1
1: 0
2: 0
3: 5
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130538639 Original CRISPR GTTAGTAATTCCCATCCAAC TGG Exonic
904851086 1:33460357-33460379 GTTTGTCATCCCCATCCACCAGG + Intergenic
905604493 1:39285714-39285736 GGTAGTAATTCTCATCCCGCAGG - Exonic
906458931 1:46022598-46022620 GTTACTAGTTCCCATCCTGCTGG - Intronic
907122338 1:52018482-52018504 GTTACTAATACCTATCCCACAGG + Intergenic
908282859 1:62560539-62560561 GGTAGAAATTACCATCCACCTGG + Intronic
921755299 1:218848463-218848485 GTTAGGAATTCCCATCAAATGGG + Intergenic
1063107956 10:3010089-3010111 GTGCGTAATTCCCATGCAACAGG + Intergenic
1069864548 10:71493539-71493561 GTTATTATTTCCCATTCCACTGG + Intronic
1070570286 10:77636152-77636174 CTGAGTAATTCCCATCCTAGGGG - Intronic
1071015159 10:80988168-80988190 ATTAGCAGTTACCATCCAACTGG - Intergenic
1073084208 10:100878026-100878048 GTTAGTGATTTACATCCAATGGG - Intergenic
1077560067 11:3254744-3254766 GTTAGTAATTCCGGTCAAAGTGG + Intergenic
1077565960 11:3300547-3300569 GTTAGTAATTCCGGTCAAAGTGG + Intergenic
1081473910 11:43405574-43405596 GTTGGCAATTCCCCACCAACAGG - Exonic
1086413492 11:86566471-86566493 GTTAGTAATTCCCTATCAAAGGG - Intronic
1090835216 11:130449045-130449067 GGTAGTCGTTCCCATCCGACTGG + Exonic
1096361507 12:50991979-50992001 GTTCATAGTTCCCATTCAACAGG + Intronic
1101647543 12:106645206-106645228 GTTAGTAAATCCCAACTCACTGG + Intronic
1107560976 13:41557088-41557110 GTTACTACTTCCCATCCACTAGG + Intergenic
1107673563 13:42771577-42771599 TTTAATAATTGCCATCTAACTGG + Intergenic
1114646045 14:24256704-24256726 GTAAGTGAGTACCATCCAACCGG + Intronic
1116075985 14:40111691-40111713 GTTAGTAATGCCCATTCCAGAGG + Intergenic
1117916399 14:60682624-60682646 TTTAATAATAGCCATCCAACTGG + Intergenic
1122673719 14:103392428-103392450 GTTAGAAATTCCAATTCTACGGG - Intronic
1124076894 15:26454713-26454735 GTTAGTACTTCCCATTCACTCGG - Intergenic
1124358286 15:29015416-29015438 GTTGGTAAATCCCATCCCAAGGG + Intronic
1124684960 15:31774723-31774745 GATAGTATTTCCCAGACAACTGG - Intronic
1126720963 15:51579171-51579193 ACTAGTAATTCCCATCAAAATGG + Intronic
1130538639 15:84804583-84804605 GTTAGTAATTCCCATCCAACTGG + Exonic
1131828068 15:96335515-96335537 GTTGGTGATTTCCATCCACCTGG - Intronic
1144711344 17:17403631-17403653 GCCAGTAATTCCCACCCAGCAGG + Intergenic
1147639705 17:41988583-41988605 GTTAGGAACTCCCTTCCAAGAGG - Intronic
1158016652 18:52791578-52791600 GTTAGTAATGCTCACCCAAGTGG + Intronic
1162365418 19:10245804-10245826 GTTAGCAATACCCCTGCAACAGG + Intergenic
925508227 2:4594081-4594103 CTTAGCCAATCCCATCCAACAGG - Intergenic
928162022 2:28936662-28936684 CTTAGTGATTGCCAGCCAACTGG - Intronic
934625270 2:95843110-95843132 TTTAGTAATTCTGATCAAACAGG - Intronic
942403584 2:175629466-175629488 GTTTGTAATTCCCTTTCTACAGG + Intergenic
943813737 2:192224137-192224159 GCTGGTAATTCTCATGCAACAGG + Intergenic
947647244 2:231751888-231751910 TTTAGTAACTCCCTTCCAAAGGG - Intronic
1168742327 20:202355-202377 TTTTGTAATGCCCATGCAACAGG - Intergenic
1169743992 20:8924954-8924976 TTTAGTAATTCACATTCATCAGG + Intronic
1182438287 22:30345498-30345520 CTTATTAAATCCCATCCAAGAGG + Intronic
956174012 3:66456595-66456617 GATAGTAATTCACAGCCAAAAGG + Intronic
963906429 3:150777439-150777461 TTTAGTAATTCTCATCTAAAAGG - Intergenic
974691403 4:65301961-65301983 TTTAGTAATTCTCATCCATATGG - Intergenic
975449068 4:74503251-74503273 GACAGAAATTCCCATCCAAAAGG + Intergenic
975509505 4:75178165-75178187 GTTATTAATCTCCATCCAAAAGG + Intergenic
975735031 4:77372730-77372752 GATAGTAATTCCCCTCCTACTGG + Intronic
976986867 4:91311942-91311964 GTTAGTAACTCCTGTCTAACAGG + Intronic
977914768 4:102579040-102579062 GTGAGTACTTCACTTCCAACAGG + Intronic
984819346 4:183866560-183866582 CTCAGTAATTCTCATCTAACTGG - Intronic
986049089 5:4070423-4070445 GTTAGTTAATCCCATTCACCTGG + Intergenic
987653714 5:20777780-20777802 GGTAGTAATTCCCATTCATTAGG - Intergenic
988741863 5:34083714-34083736 GGTAGTAATTCCCATTCATTAGG + Intronic
994567754 5:101473955-101473977 GTTAGAAATTCCAATCCTTCAGG + Intergenic
1002679658 5:180950781-180950803 GTCAGGAATTCCCATCTCACAGG + Exonic
1006886084 6:37383390-37383412 TTTAAAAATTCCCATGCAACAGG - Intronic
1007384651 6:41512478-41512500 CTTGGTAATTTCCATCGAACTGG - Intergenic
1008771238 6:54981254-54981276 TTCTGTAATTCCCTTCCAACTGG - Intergenic
1010743410 6:79534530-79534552 TTAAGTAATTCCCAACCAAGAGG + Intronic
1020345729 7:7161342-7161364 GTTAGTGATTTTCATCCAAGGGG - Intronic
1020967337 7:14887984-14888006 TTTAATAACTCCCATTCAACAGG - Intronic
1026957005 7:74383303-74383325 GTTAGTAATTCCAATCAATGAGG - Intronic
1028024096 7:85814621-85814643 GTTAGTATTTCCCATCAATCTGG + Intergenic
1031386385 7:121157103-121157125 GTTAGTAATGCCAATCCTCCAGG - Intronic
1035390360 7:158500361-158500383 GGTAGTAATTCCCAGCACACTGG - Intronic
1043829297 8:84968906-84968928 GTAAGCATTTCCCATGCAACAGG + Intergenic
1044080055 8:87872663-87872685 GTTTGTAGATCCCATCCATCCGG - Exonic
1045777917 8:105827771-105827793 GTTAGTAATTCCTAGTCAAGTGG - Intergenic
1047985966 8:130234119-130234141 GTTAGTAATTGCAATACAATGGG + Intronic
1048607892 8:135988963-135988985 TATAGTGATCCCCATCCAACTGG - Intergenic
1051418322 9:16866848-16866870 CTATATAATTCCCATCCAACAGG + Intronic
1053385915 9:37688381-37688403 GTCAATAATTTCCATCCTACTGG + Intronic
1053610138 9:39704746-39704768 TTCAATAATTCCCATCCTACTGG + Intergenic
1054088115 9:60766401-60766423 TTCAATAATTCCCATCCTACTGG - Intergenic
1054243386 9:62637649-62637671 TTCAATAATTCCCATCCTACTGG - Intergenic
1054557510 9:66672170-66672192 TTCAATAATTCCCATCCTACTGG - Intergenic
1054828196 9:69594451-69594473 GTTACTATTTCCCATGAAACAGG + Intronic
1060813465 9:126622934-126622956 GGTAGTAATTCCAATCTTACAGG + Intronic
1186158885 X:6755602-6755624 GTTAGCTATTTTCATCCAACTGG - Intergenic
1186539215 X:10383099-10383121 GTTAAGAATTCCCATCCAAAGGG - Intergenic
1187827997 X:23352184-23352206 GTTGGTAATTCCCATCTGGCTGG + Intronic
1189866286 X:45331392-45331414 GTTAACATTTACCATCCAACTGG + Intergenic
1189943533 X:46153053-46153075 GATAGTCAATACCATCCAACAGG + Intergenic
1197305429 X:124835612-124835634 GTTAATATTTCCCATCCTATTGG + Intronic
1197321691 X:125039856-125039878 CTTGGTAATTCCCATTTAACTGG + Intergenic