ID: 1130541940

View in Genome Browser
Species Human (GRCh38)
Location 15:84826756-84826778
Sequence GAAACATGGTTGGCTGCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 131}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130541940_1130541949 12 Left 1130541940 15:84826756-84826778 CCTGGAGCAGCCAACCATGTTTC 0: 1
1: 0
2: 2
3: 12
4: 131
Right 1130541949 15:84826791-84826813 GGTATCCAGGGATGGAGCAGGGG 0: 1
1: 0
2: 2
3: 43
4: 339
1130541940_1130541947 10 Left 1130541940 15:84826756-84826778 CCTGGAGCAGCCAACCATGTTTC 0: 1
1: 0
2: 2
3: 12
4: 131
Right 1130541947 15:84826789-84826811 GTGGTATCCAGGGATGGAGCAGG 0: 1
1: 0
2: 0
3: 31
4: 289
1130541940_1130541945 0 Left 1130541940 15:84826756-84826778 CCTGGAGCAGCCAACCATGTTTC 0: 1
1: 0
2: 2
3: 12
4: 131
Right 1130541945 15:84826779-84826801 ACTTCAGCATGTGGTATCCAGGG 0: 1
1: 0
2: 0
3: 15
4: 150
1130541940_1130541946 4 Left 1130541940 15:84826756-84826778 CCTGGAGCAGCCAACCATGTTTC 0: 1
1: 0
2: 2
3: 12
4: 131
Right 1130541946 15:84826783-84826805 CAGCATGTGGTATCCAGGGATGG 0: 1
1: 0
2: 1
3: 21
4: 214
1130541940_1130541944 -1 Left 1130541940 15:84826756-84826778 CCTGGAGCAGCCAACCATGTTTC 0: 1
1: 0
2: 2
3: 12
4: 131
Right 1130541944 15:84826778-84826800 CACTTCAGCATGTGGTATCCAGG 0: 1
1: 0
2: 0
3: 11
4: 120
1130541940_1130541951 24 Left 1130541940 15:84826756-84826778 CCTGGAGCAGCCAACCATGTTTC 0: 1
1: 0
2: 2
3: 12
4: 131
Right 1130541951 15:84826803-84826825 TGGAGCAGGGGAGCCACAGCTGG 0: 1
1: 1
2: 8
3: 57
4: 432
1130541940_1130541943 -9 Left 1130541940 15:84826756-84826778 CCTGGAGCAGCCAACCATGTTTC 0: 1
1: 0
2: 2
3: 12
4: 131
Right 1130541943 15:84826770-84826792 CCATGTTTCACTTCAGCATGTGG 0: 1
1: 0
2: 0
3: 19
4: 180
1130541940_1130541948 11 Left 1130541940 15:84826756-84826778 CCTGGAGCAGCCAACCATGTTTC 0: 1
1: 0
2: 2
3: 12
4: 131
Right 1130541948 15:84826790-84826812 TGGTATCCAGGGATGGAGCAGGG 0: 1
1: 0
2: 4
3: 27
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130541940 Original CRISPR GAAACATGGTTGGCTGCTCC AGG (reversed) Intronic
903166414 1:21523645-21523667 GACACATGCTGGGCTGCCCCAGG - Intronic
905248386 1:36630308-36630330 GAAACAATGTTGGCTGGTCCAGG - Intergenic
905728672 1:40278056-40278078 CAAACATGTTTGGCTCTTCCTGG + Intronic
906573263 1:46862703-46862725 GCACCAGTGTTGGCTGCTCCAGG - Intergenic
908510739 1:64848216-64848238 GAAACAGGGATGGAGGCTCCTGG + Intronic
909480532 1:76125174-76125196 GAAACCTTGTTGGCTGCTCCTGG - Intronic
910610997 1:89141904-89141926 GAAATCTGGTTGTCTGCACCGGG - Intronic
910701137 1:90075402-90075424 GAAATATCGTTGGCAGCTGCTGG - Intergenic
910954011 1:92681896-92681918 GAAACATGGTAGGGTGCTAGGGG - Intronic
914907381 1:151757690-151757712 GAAAGATGGTTGACTGCTTTTGG - Intergenic
915553443 1:156648018-156648040 GAGACATGGATGGCTTCCCCGGG + Exonic
916425780 1:164678291-164678313 CAAACAGGGCTGGCGGCTCCTGG - Intronic
921028111 1:211308625-211308647 GAAACATGGTAAGCTGCTTATGG - Intronic
922738711 1:228004112-228004134 AACACATGGCTGGCTGCTCAGGG + Intergenic
1064256081 10:13743759-13743781 TAAACATGGTGGGCTTATCCTGG + Intronic
1066214964 10:33277372-33277394 GAAACAAGGTTGGCTCCTGGAGG + Intronic
1067539144 10:47139005-47139027 GAAACATGGTAGGCTGTTTTTGG - Intergenic
1070220610 10:74439491-74439513 GAATAATGGTCGGCTGCTCTAGG - Intronic
1072063043 10:91835896-91835918 GAGACATGGTTGGCTGGGCGTGG - Intronic
1072725953 10:97814137-97814159 GAGACATGATTTGCTGCTTCAGG + Intergenic
1074384938 10:113009302-113009324 GAGACAGGGAAGGCTGCTCCAGG - Intronic
1075321240 10:121493204-121493226 GGAAGATGGTTAGCTTCTCCCGG + Intronic
1076120324 10:127931586-127931608 GAGAAATGGCTTGCTGCTCCTGG - Intronic
1078725254 11:13924307-13924329 ACAACTTAGTTGGCTGCTCCAGG + Intergenic
1083001073 11:59291168-59291190 GCAACCTGGTGGTCTGCTCCAGG + Intergenic
1084439463 11:69164307-69164329 GAAACATGGTTGGCCACTGTGGG + Intergenic
1085051416 11:73382102-73382124 GAACCCTGGTGGGTTGCTCCAGG + Intronic
1087011256 11:93516200-93516222 GAACCATGCTTGGCAGGTCCCGG + Intronic
1089945001 11:122461706-122461728 GAAACATGGACTGCTGCTGCTGG + Intergenic
1090612091 11:128480360-128480382 GAAAGATGACTGGCTGCTCCAGG + Exonic
1093272446 12:17081330-17081352 GGAACAGGGTTGGCAGGTCCAGG + Intergenic
1094035321 12:26064105-26064127 GAAACATGAGGGGCTGGTCCAGG - Intronic
1098381105 12:69870377-69870399 GAGACAGGGTTGGCCGCTCAGGG + Intronic
1103619944 12:122181251-122181273 GACATATGGTTGGCTGGGCCCGG + Intronic
1104427592 12:128690918-128690940 GAACCATGGATGGCTACTCTGGG - Intronic
1105022376 12:132825730-132825752 GAAAGATGGTCGGCTGCTTTTGG - Intronic
1105203408 13:18198621-18198643 GAAACTTGGATGTATGCTCCCGG - Intergenic
1108828956 13:54452931-54452953 GAAACATGGTTTTGTGTTCCAGG - Intergenic
1109978890 13:69879566-69879588 GAAACATTTTTTGCTGCTCTTGG - Intronic
1111277567 13:85969840-85969862 AAAACATGTTTGGCTGTTTCAGG + Intergenic
1111307493 13:86434401-86434423 GAAACATGGTTTCCTGGGCCTGG + Intergenic
1112467087 13:99653962-99653984 GAAACATGGTTAGGTGGTGCAGG + Intronic
1116419104 14:44712742-44712764 GTGAAATGGTTGGCTGCTTCCGG - Intergenic
1121055219 14:90846363-90846385 GAAACATCCTGTGCTGCTCCTGG - Intergenic
1127308483 15:57730466-57730488 GGAACCTGGTTGGCTCCTTCTGG - Intronic
1130541940 15:84826756-84826778 GAAACATGGTTGGCTGCTCCAGG - Intronic
1130754338 15:86746561-86746583 CAAACATGGTTACCAGCTCCTGG - Intronic
1131381794 15:91970380-91970402 GCAACTTTGCTGGCTGCTCCAGG - Intronic
1132906482 16:2285215-2285237 GTAACCAGGATGGCTGCTCCGGG + Intronic
1140423619 16:74842034-74842056 GAAACAAGGTTAGCTGGTGCTGG + Intergenic
1140904655 16:79400085-79400107 GAGACATTTTTGGTTGCTCCAGG + Intergenic
1142069347 16:88082412-88082434 GAAACACTGGTGTCTGCTCCTGG - Intronic
1142674793 17:1507053-1507075 GAAACATGACCCGCTGCTCCGGG - Exonic
1144390085 17:14785047-14785069 GCAGCAGGGTTGGCAGCTCCAGG - Intergenic
1146528153 17:33584597-33584619 CAGCCCTGGTTGGCTGCTCCAGG - Intronic
1152180057 17:78813873-78813895 GCAACATCCTTGGCTGCTTCAGG - Exonic
1156445977 18:37237011-37237033 GAAACAAGGTTGACAGCTCCTGG + Intergenic
1157185663 18:45538258-45538280 GAAATATGGTTGCCTCTTCCTGG + Intronic
1158354557 18:56602607-56602629 TTAACATGGTTAGCTGTTCCAGG + Exonic
1158453270 18:57585993-57586015 GAAACGTGGGAGGCTGTTCCTGG + Intronic
1161207695 19:3050169-3050191 GAAAAAAGATAGGCTGCTCCTGG - Intergenic
1164941035 19:32252486-32252508 GAGGCATGGTGGGCTGCTCTGGG - Intergenic
1167343066 19:48927609-48927631 GAAACAGGGTTGGCTGGGCGTGG - Intergenic
1167438957 19:49497208-49497230 GAAAGATGGTCGGCTGCTTTTGG - Exonic
926055923 2:9773958-9773980 CAAACAGGGTTGGTTCCTCCTGG + Intergenic
926445697 2:12939501-12939523 TAAACATGGTAGGCTGCTTCTGG + Intergenic
926474403 2:13304257-13304279 GAAGCATGCTAGGCTGCTCTGGG - Intergenic
928477827 2:31649072-31649094 GAAACATGGTTGGGTTCTAGAGG - Intergenic
929096276 2:38266222-38266244 GAGAAATGGTTGGCCCCTCCAGG + Intergenic
931178041 2:59873082-59873104 AAGACATGGTTGTCAGCTCCAGG + Intergenic
931661327 2:64566088-64566110 GATACATGATTGGCTCCTCCTGG - Intronic
932089974 2:68797698-68797720 GAAACCTGGCTGGCTGCTGTGGG - Intronic
935653993 2:105406124-105406146 GAAAGATGCTTGGTTGTTCCAGG - Intronic
937050664 2:118885892-118885914 GAAACATGTTTGGCTACATCAGG - Intergenic
939072568 2:137560788-137560810 GACACATGGTGGGCTGCTAGGGG - Intronic
940665873 2:156608906-156608928 GAAAATTGGTGGGCTGCTACTGG + Intronic
940849769 2:158676970-158676992 GGAACATGGTTTGCTGCTGGGGG - Intronic
941003046 2:160221424-160221446 GAGAGATGGCTGGCTGCTGCTGG + Intronic
946032027 2:216712994-216713016 GGAACATTGTTGGATGCTACAGG - Intergenic
946043031 2:216798703-216798725 GAAAGATGGTTGGATGATCCAGG + Intergenic
1172780785 20:37436041-37436063 GATAGATGGATGGATGCTCCTGG - Intergenic
1174465868 20:50716881-50716903 GAAACAGGGTTGGCTGGGCGTGG + Intergenic
1174479542 20:50821095-50821117 GATACAGTGCTGGCTGCTCCCGG + Intronic
1174952348 20:55056063-55056085 GAATAATGGTTGGCTGGGCCTGG + Intergenic
1175184900 20:57173467-57173489 GAAACATGGGTGGCCTCTCATGG + Intronic
1177317198 21:19477384-19477406 GAAACATGGTTTGCTGGGCCAGG - Intergenic
1177370922 21:20202185-20202207 GGTATTTGGTTGGCTGCTCCTGG + Intergenic
1179021208 21:37642660-37642682 TAAACATGGTCGGATGCTCACGG - Intronic
1184079964 22:42212385-42212407 GAATCATGGGTTGCTGCTCCAGG + Exonic
1184272072 22:43390139-43390161 GAAACTGGGGTGGGTGCTCCTGG + Intergenic
950256278 3:11509246-11509268 CCAACTTGGTTGGCTGCTGCCGG + Intronic
953930241 3:47002367-47002389 GGGACATGGTTGGCTGTACCTGG - Exonic
954898109 3:53994807-53994829 GAAACCAGGGTGGCTGCTCCAGG + Intergenic
955161813 3:56470820-56470842 AAAACATGGTCTGTTGCTCCAGG + Intergenic
957653085 3:83034993-83035015 GACACAGGGCAGGCTGCTCCAGG + Intergenic
964490470 3:157230632-157230654 GACACATGGTTGGTGTCTCCTGG + Intergenic
968609738 4:1551532-1551554 GGAACCCGCTTGGCTGCTCCAGG - Intergenic
972635710 4:40882343-40882365 GAGACATTGTTGGCTGCTGATGG + Intronic
973199500 4:47484366-47484388 GAAACTTGTTTGGCTTCTCTTGG + Intergenic
977055374 4:92183885-92183907 AAAACATGCTTGGGTACTCCAGG + Intergenic
977918964 4:102623284-102623306 GTAACCTGGTTGTCTGCTACTGG - Intergenic
979230384 4:118342374-118342396 GAAGAATGGTTGGTTGCTCTAGG - Intronic
987954427 5:24719633-24719655 GAAGTATGGTTGGCTACTACAGG - Intergenic
988879539 5:35486222-35486244 GAGCCATGGTTGGCAGGTCCAGG - Intergenic
990620641 5:57555198-57555220 GAAACATGGTTTGCTGGTGTCGG + Intergenic
991165520 5:63562540-63562562 AAAACATGGCTAGCTGCTCTTGG + Intergenic
993977388 5:94499124-94499146 GAAATATGATTAGTTGCTCCAGG + Intronic
994710055 5:103255870-103255892 GAACCATAGGTGGCAGCTCCAGG + Intergenic
998577133 5:143328298-143328320 GAAAAATGGTTTCCTGCTCAGGG - Intronic
999373461 5:151070078-151070100 GAAAGGTGAGTGGCTGCTCCAGG - Intronic
999400085 5:151257745-151257767 CAAAGAAGCTTGGCTGCTCCAGG - Intronic
1000446423 5:161327804-161327826 TAAGCATTGTTGGCTGCTCTGGG - Intronic
1003223293 6:4180974-4180996 GAAACGTGATTGTCTGCTGCTGG + Intergenic
1003968907 6:11279929-11279951 GAAACATCGTGGGTGGCTCCCGG + Intronic
1004638896 6:17494970-17494992 GAAAGATCGTTGGCTCTTCCTGG + Intronic
1006467631 6:34205509-34205531 GACATATTGTTGGCAGCTCCTGG + Intergenic
1011170584 6:84500261-84500283 GAAATTTGGTTGGATTCTCCTGG - Intergenic
1012325775 6:97915110-97915132 GAATCATGGTAGGCTACTCCGGG - Intergenic
1013275914 6:108584906-108584928 GAAACATGGTAGCCTGCACAGGG + Intronic
1013627275 6:111950747-111950769 AGAGCATGGTTGGCTGCTTCAGG + Intergenic
1017803719 6:157924295-157924317 GAAACAAGATTGGCACCTCCCGG + Intronic
1022564299 7:31382137-31382159 GAAAAATCTGTGGCTGCTCCAGG - Intergenic
1024063718 7:45716591-45716613 GCAACAGGGTTGGCTGTGCCAGG - Exonic
1024784193 7:52887070-52887092 GATTCATGGCTGGCTGCTCTAGG + Intergenic
1027125597 7:75554694-75554716 GAAACAGAATTGTCTGCTCCTGG + Intronic
1030827524 7:114178148-114178170 GAAACATTCTTTGCAGCTCCTGG + Intronic
1034246348 7:149647410-149647432 GACACATGGTTTGAGGCTCCTGG + Intergenic
1034885385 7:154794628-154794650 GAAACATGGCTGGCCTCACCAGG - Intronic
1035261044 7:157661807-157661829 GAAACATGGCTGGTGCCTCCGGG - Intronic
1042510955 8:69610403-69610425 GAAACAGGTTTGTCTGCTTCTGG - Intronic
1043346030 8:79298846-79298868 TAAACAGGGATGGCTGCTGCTGG + Intergenic
1047989493 8:130271028-130271050 GAAACAAGAATGGCTGCTCCTGG + Intronic
1050238876 9:3613264-3613286 GAAGCATAGTTTGCAGCTCCAGG - Intergenic
1053115873 9:35501692-35501714 GAACCATGGTTGGCTGCTACTGG - Intronic
1053314153 9:37037571-37037593 GAAACATCGTTGGGGGCTCCAGG + Intergenic
1056687666 9:88779646-88779668 GCAACATGTTCAGCTGCTCCTGG + Intergenic
1057911521 9:99023536-99023558 GAAACTGGATTGGCTGCTGCTGG + Intronic
1059275211 9:113090483-113090505 GAAAGGTGGTTGGCTGGGCCTGG + Intergenic
1060966676 9:127715682-127715704 GCAACACGATTGGCTGCTGCGGG - Exonic
1062423939 9:136497540-136497562 GAAACAGGGGTGTCTCCTCCTGG + Exonic
1062450826 9:136614999-136615021 GAAAGATGGTAGGCAGCCCCAGG + Intergenic
1188804531 X:34570659-34570681 AAAACATGGTTTTCTGCACCAGG - Intergenic
1189287941 X:39865447-39865469 GAAAGATGGTCGGCTGCTTTTGG - Intergenic
1195695462 X:107663677-107663699 GAAACAAGGTTAGCTGCCCTGGG - Intergenic
1198715134 X:139550465-139550487 GAAAAATGGTGGGCAGGTCCTGG + Intronic
1199610601 X:149609703-149609725 GGAACATGGTTGGGTCCTACAGG - Intronic