ID: 1130543836

View in Genome Browser
Species Human (GRCh38)
Location 15:84840585-84840607
Sequence ACCCTGAGTGTCCGGGCGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 75}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130543830_1130543836 1 Left 1130543830 15:84840561-84840583 CCTCTTGGGGAAGAGGGACCCCA 0: 1
1: 0
2: 3
3: 25
4: 185
Right 1130543836 15:84840585-84840607 ACCCTGAGTGTCCGGGCGCCTGG 0: 1
1: 0
2: 0
3: 7
4: 75
1130543821_1130543836 26 Left 1130543821 15:84840536-84840558 CCTGGAGAACACCCAGGCAGTCA 0: 1
1: 0
2: 5
3: 59
4: 328
Right 1130543836 15:84840585-84840607 ACCCTGAGTGTCCGGGCGCCTGG 0: 1
1: 0
2: 0
3: 7
4: 75
1130543824_1130543836 15 Left 1130543824 15:84840547-84840569 CCCAGGCAGTCAGGCCTCTTGGG 0: 1
1: 0
2: 2
3: 47
4: 803
Right 1130543836 15:84840585-84840607 ACCCTGAGTGTCCGGGCGCCTGG 0: 1
1: 0
2: 0
3: 7
4: 75
1130543826_1130543836 14 Left 1130543826 15:84840548-84840570 CCAGGCAGTCAGGCCTCTTGGGG 0: 1
1: 0
2: 1
3: 23
4: 245
Right 1130543836 15:84840585-84840607 ACCCTGAGTGTCCGGGCGCCTGG 0: 1
1: 0
2: 0
3: 7
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130543836 Original CRISPR ACCCTGAGTGTCCGGGCGCC TGG Exonic