ID: 1130543911

View in Genome Browser
Species Human (GRCh38)
Location 15:84840866-84840888
Sequence CCCGGGTGCCATGTCTCCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 68}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130543911_1130543916 -6 Left 1130543911 15:84840866-84840888 CCGGCGGAGACATGGCACCCGGG 0: 1
1: 0
2: 1
3: 6
4: 68
Right 1130543916 15:84840883-84840905 CCCGGGACAGCACGTTGCAGGGG 0: 1
1: 0
2: 0
3: 10
4: 76
1130543911_1130543921 22 Left 1130543911 15:84840866-84840888 CCGGCGGAGACATGGCACCCGGG 0: 1
1: 0
2: 1
3: 6
4: 68
Right 1130543921 15:84840911-84840933 AGGCCACAGGACTCCAGGAGAGG 0: 1
1: 0
2: 2
3: 36
4: 511
1130543911_1130543920 17 Left 1130543911 15:84840866-84840888 CCGGCGGAGACATGGCACCCGGG 0: 1
1: 0
2: 1
3: 6
4: 68
Right 1130543920 15:84840906-84840928 CAAGCAGGCCACAGGACTCCAGG 0: 1
1: 0
2: 0
3: 20
4: 249
1130543911_1130543914 -7 Left 1130543911 15:84840866-84840888 CCGGCGGAGACATGGCACCCGGG 0: 1
1: 0
2: 1
3: 6
4: 68
Right 1130543914 15:84840882-84840904 ACCCGGGACAGCACGTTGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 58
1130543911_1130543913 -8 Left 1130543911 15:84840866-84840888 CCGGCGGAGACATGGCACCCGGG 0: 1
1: 0
2: 1
3: 6
4: 68
Right 1130543913 15:84840881-84840903 CACCCGGGACAGCACGTTGCAGG 0: 1
1: 0
2: 0
3: 3
4: 122
1130543911_1130543918 2 Left 1130543911 15:84840866-84840888 CCGGCGGAGACATGGCACCCGGG 0: 1
1: 0
2: 1
3: 6
4: 68
Right 1130543918 15:84840891-84840913 AGCACGTTGCAGGGGCAAGCAGG 0: 1
1: 0
2: 3
3: 25
4: 375
1130543911_1130543919 9 Left 1130543911 15:84840866-84840888 CCGGCGGAGACATGGCACCCGGG 0: 1
1: 0
2: 1
3: 6
4: 68
Right 1130543919 15:84840898-84840920 TGCAGGGGCAAGCAGGCCACAGG 0: 1
1: 0
2: 0
3: 32
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130543911 Original CRISPR CCCGGGTGCCATGTCTCCGC CGG (reversed) Exonic
900294953 1:1944140-1944162 CCCAGGTGCCATGTCCCCGCTGG + Intronic
902600974 1:17539964-17539986 CGCGGGGGCCCTGCCTCCGCGGG + Intronic
904500776 1:30911628-30911650 CCCGGGTCCCAGGTCTCCCTGGG + Intergenic
906109356 1:43312750-43312772 CCCAAGTCCCATGTCCCCGCTGG - Intronic
918074768 1:181161659-181161681 CCCGGGTGACAGCTCTCCCCAGG - Intergenic
921159906 1:212465363-212465385 CCCAGTGGCCATGTCTCTGCAGG + Intergenic
921265282 1:213416656-213416678 CCCTGGTGTCGTGCCTCCGCTGG + Intergenic
921971614 1:221155178-221155200 CCCGTGTGCCATGTCTTCTAGGG + Intergenic
924436396 1:244047984-244048006 CCCGGGTGCCCTGCCTCTCCAGG + Intergenic
1063577511 10:7275112-7275134 CCCGGGTGCCCTGGTCCCGCAGG + Intronic
1067215615 10:44300223-44300245 CCCAGGTGCCAAGGCTCCTCTGG - Intergenic
1067635370 10:47998136-47998158 CCTGGGTTTCATGTCTCAGCTGG - Intergenic
1067722368 10:48738475-48738497 CCTGGGTGCCAAGTCACTGCTGG + Intronic
1070695146 10:78557562-78557584 CCAGAGTGCCATCTCTCCACTGG + Intergenic
1072274202 10:93806653-93806675 CCTGGCTGCCATGACTCCTCAGG - Intergenic
1073076775 10:100829343-100829365 CCCGGCCGCCCTGTCTCCGCAGG + Exonic
1074460439 10:113631889-113631911 GCTGGATGCCATGTCTCTGCTGG - Exonic
1075926243 10:126253964-126253986 CCAGGGCGCTATGTCTCTGCCGG + Intronic
1083294158 11:61706329-61706351 CCTGGGTGCCATGTCTCTTTCGG + Intronic
1090859521 11:130640522-130640544 CCCAGCTGCCATTTCTCCCCTGG - Intergenic
1091788109 12:3255312-3255334 CCTGGGGGCCATGTCTCCTCAGG - Intronic
1101326104 12:103717189-103717211 CCCATGTCCCATGTCTGCGCAGG - Intronic
1103362415 12:120361886-120361908 CCCGGTTGCCATGGCAACGCCGG + Intronic
1113076091 13:106469336-106469358 CCCGGGTGCCGTGTGTCTGCAGG - Intergenic
1122588104 14:102825317-102825339 CACGGGTGCCAGGTCCCCGCAGG - Intronic
1122892502 14:104739306-104739328 CCTGTGTGCCGTGTCCCCGCAGG + Exonic
1128496338 15:68200626-68200648 CCCGGGTGCCTCGTCTGGGCTGG - Intronic
1129162190 15:73753082-73753104 CCCGGGCGCCGGGTCGCCGCCGG + Intergenic
1130543911 15:84840866-84840888 CCCGGGTGCCATGTCTCCGCCGG - Exonic
1132318104 15:100905000-100905022 CCTGGGTGCCATGTATCACCTGG - Intronic
1132761380 16:1510139-1510161 CCAGGCTGCCATGTCCCGGCGGG - Exonic
1136315058 16:29449517-29449539 CCAGGATGCCGTGTCTCGGCTGG + Intronic
1136429635 16:30188856-30188878 CCAGGATGCCGTGTCTCGGCTGG + Exonic
1136536325 16:30902056-30902078 CCCGCCGGCCGTGTCTCCGCAGG + Exonic
1139471497 16:67180319-67180341 CCAGGGTGCCACGCCCCCGCCGG + Exonic
1144903944 17:18625020-18625042 CCCGGGTGCCATGGGGCCTCCGG + Intergenic
1150069702 17:62140298-62140320 CCCCGGTGCCCTGTGGCCGCTGG - Intergenic
1150907435 17:69352717-69352739 CTCTGGTGCCATGTCTGGGCTGG - Intergenic
1152719854 17:81918120-81918142 CCCGGCTGCCATCGCTCCCCTGG + Exonic
1154027855 18:10724887-10724909 CCAGGGTGCCACGCCCCCGCCGG - Intronic
1160728572 19:629996-630018 CCCCGGTGCCCTGTGGCCGCTGG - Exonic
1162901838 19:13799853-13799875 CCCGGGTGCCCTTTACCCGCGGG + Exonic
1163020973 19:14480567-14480589 CCGGGGTGCCCCGTCTCCCCAGG + Intronic
1164608629 19:29617552-29617574 CAGGGCTGCCATGTCTCCACAGG + Intergenic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
1167268896 19:48497493-48497515 GCTGAGTGCCGTGTCTCCGCCGG + Exonic
926088761 2:10036604-10036626 CCCTGCTGCCCTGTCTGCGCTGG + Intergenic
929789829 2:45014202-45014224 CCCGGGCCCCATGGCTCCGCCGG + Intergenic
932574030 2:72953041-72953063 CCCGGGTGGCAGGCCTCGGCGGG - Intronic
936515079 2:113176232-113176254 TCCGGGTGCCAGGTGTCAGCTGG + Intronic
1168958013 20:1848308-1848330 CCCAGGTGCCATATCTCACCTGG - Intergenic
1172588254 20:36100096-36100118 CCAGGGTGGCATTTCTCAGCAGG + Intronic
1173417001 20:42865769-42865791 CCAGGGTGCCAATTCTCCGCAGG + Intronic
1175697935 20:61116593-61116615 CCTGGGTGCCAAGTTTCTGCTGG - Intergenic
1178606065 21:34037071-34037093 CCCGGGTGCCACCTCCCCACTGG - Intergenic
1179148747 21:38792758-38792780 CACTGGTGCCATGTCTCCAAAGG - Intergenic
1184796773 22:46737728-46737750 CCCGGGTCCCACCTCCCCGCGGG + Intronic
1185183532 22:49378474-49378496 CCCGGATTCCATGTGTCAGCTGG - Intergenic
951192038 3:19782619-19782641 GCTGGGTGCCTTGTCTCCGTGGG - Intergenic
954708118 3:52491850-52491872 CCCAGGTGGCATCTCTCTGCAGG + Exonic
961551159 3:127671374-127671396 CTGGGGTGCCATGGCTCCTCTGG - Intronic
961736242 3:129003772-129003794 CCCTGCTGCCCTGTCCCCGCAGG + Exonic
963870752 3:150410648-150410670 CCGGGGGGCCATGGCTTCGCTGG - Exonic
1002455918 5:179345316-179345338 TCCGGCTGCCATGGATCCGCCGG - Exonic
1002632384 5:180590564-180590586 CCCGGGTGCCCTTCCTGCGCGGG - Intronic
1012252284 6:96992212-96992234 CCCGGGAGCCATGGATCCCCTGG - Intronic
1022350604 7:29563971-29563993 CCAGGGTCCCATCTCTCAGCCGG + Exonic
1037219357 8:16499073-16499095 ACCAGGTGCCATGTCTGCCCAGG + Intronic
1037920928 8:22804921-22804943 CCCGGCTGCCCTGTCCTCGCAGG + Intronic
1040459887 8:47637173-47637195 CTCAGTTGCCATGTCTCCTCAGG + Intronic
1045583411 8:103501518-103501540 CCCTGGTCCCACGCCTCCGCGGG + Intronic
1057197022 9:93120984-93121006 CCCGGGAGCCAGGTTTCCACTGG + Intergenic
1060355651 9:122905049-122905071 CCCGGGTGCCTGGTCCCCGGCGG - Intronic
1062045875 9:134424252-134424274 CCCTGGTGCCATGAGTCCCCAGG + Intronic
1062052759 9:134456049-134456071 CCTGGGAGCCACGTCTCCACCGG - Intergenic
1062502443 9:136857295-136857317 CCCGGGTGCCAGGCCTCACCTGG - Exonic