ID: 1130546409

View in Genome Browser
Species Human (GRCh38)
Location 15:84859904-84859926
Sequence GTGAGTGTGCCCCGCGGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 156}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130546400_1130546409 4 Left 1130546400 15:84859877-84859899 CCACCGACTTCTGCCTCAGCCCT 0: 1
1: 0
2: 3
3: 30
4: 444
Right 1130546409 15:84859904-84859926 GTGAGTGTGCCCCGCGGCCCGGG 0: 1
1: 0
2: 0
3: 15
4: 156
1130546398_1130546409 27 Left 1130546398 15:84859854-84859876 CCACAATGAGCACGGCTCGGCCT 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1130546409 15:84859904-84859926 GTGAGTGTGCCCCGCGGCCCGGG 0: 1
1: 0
2: 0
3: 15
4: 156
1130546401_1130546409 1 Left 1130546401 15:84859880-84859902 CCGACTTCTGCCTCAGCCCTGAG 0: 1
1: 0
2: 4
3: 34
4: 440
Right 1130546409 15:84859904-84859926 GTGAGTGTGCCCCGCGGCCCGGG 0: 1
1: 0
2: 0
3: 15
4: 156
1130546404_1130546409 -9 Left 1130546404 15:84859890-84859912 CCTCAGCCCTGAGGGTGAGTGTG 0: 1
1: 0
2: 1
3: 40
4: 357
Right 1130546409 15:84859904-84859926 GTGAGTGTGCCCCGCGGCCCGGG 0: 1
1: 0
2: 0
3: 15
4: 156
1130546399_1130546409 7 Left 1130546399 15:84859874-84859896 CCTCCACCGACTTCTGCCTCAGC 0: 1
1: 0
2: 0
3: 32
4: 365
Right 1130546409 15:84859904-84859926 GTGAGTGTGCCCCGCGGCCCGGG 0: 1
1: 0
2: 0
3: 15
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130546409 Original CRISPR GTGAGTGTGCCCCGCGGCCC GGG Intronic