ID: 1130548760

View in Genome Browser
Species Human (GRCh38)
Location 15:84875584-84875606
Sequence ATTTACCCCAGGGCAGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130548750_1130548760 27 Left 1130548750 15:84875534-84875556 CCTTCAGGCTGGGACCCAAGAGG No data
Right 1130548760 15:84875584-84875606 ATTTACCCCAGGGCAGGGTCTGG No data
1130548755_1130548760 4 Left 1130548755 15:84875557-84875579 CCTTGATGAGTGGCACTAAATTG No data
Right 1130548760 15:84875584-84875606 ATTTACCCCAGGGCAGGGTCTGG No data
1130548753_1130548760 13 Left 1130548753 15:84875548-84875570 CCCAAGAGGCCTTGATGAGTGGC No data
Right 1130548760 15:84875584-84875606 ATTTACCCCAGGGCAGGGTCTGG No data
1130548754_1130548760 12 Left 1130548754 15:84875549-84875571 CCAAGAGGCCTTGATGAGTGGCA No data
Right 1130548760 15:84875584-84875606 ATTTACCCCAGGGCAGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130548760 Original CRISPR ATTTACCCCAGGGCAGGGTC TGG Intergenic
No off target data available for this crispr