ID: 1130550079

View in Genome Browser
Species Human (GRCh38)
Location 15:84884766-84884788
Sequence CAGTAGGAGAGGAGGGAAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2001
Summary {0: 1, 1: 3, 2: 19, 3: 199, 4: 1779}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130550070_1130550079 16 Left 1130550070 15:84884727-84884749 CCTCTGGATGCTGACAGAAACAA 0: 1
1: 0
2: 1
3: 30
4: 251
Right 1130550079 15:84884766-84884788 CAGTAGGAGAGGAGGGAAGGCGG 0: 1
1: 3
2: 19
3: 199
4: 1779
1130550068_1130550079 25 Left 1130550068 15:84884718-84884740 CCTGGCTTCCCTCTGGATGCTGA 0: 1
1: 0
2: 2
3: 26
4: 311
Right 1130550079 15:84884766-84884788 CAGTAGGAGAGGAGGGAAGGCGG 0: 1
1: 3
2: 19
3: 199
4: 1779
1130550069_1130550079 17 Left 1130550069 15:84884726-84884748 CCCTCTGGATGCTGACAGAAACA 0: 1
1: 0
2: 0
3: 21
4: 230
Right 1130550079 15:84884766-84884788 CAGTAGGAGAGGAGGGAAGGCGG 0: 1
1: 3
2: 19
3: 199
4: 1779

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130550079 Original CRISPR CAGTAGGAGAGGAGGGAAGG CGG Intronic
Too many off-targets to display for this crispr