ID: 1130550456

View in Genome Browser
Species Human (GRCh38)
Location 15:84887364-84887386
Sequence CACAAGGACTTGCCTCTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 90}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130550449_1130550456 27 Left 1130550449 15:84887314-84887336 CCCTATGAAGTGGGCAGAATTTG 0: 1
1: 0
2: 1
3: 15
4: 185
Right 1130550456 15:84887364-84887386 CACAAGGACTTGCCTCTTACAGG 0: 1
1: 0
2: 0
3: 7
4: 90
1130550450_1130550456 26 Left 1130550450 15:84887315-84887337 CCTATGAAGTGGGCAGAATTTGC 0: 1
1: 0
2: 0
3: 5
4: 137
Right 1130550456 15:84887364-84887386 CACAAGGACTTGCCTCTTACAGG 0: 1
1: 0
2: 0
3: 7
4: 90
1130550452_1130550456 -5 Left 1130550452 15:84887346-84887368 CCTGGAACTCCCAGAGTTCACAA 0: 1
1: 0
2: 1
3: 15
4: 186
Right 1130550456 15:84887364-84887386 CACAAGGACTTGCCTCTTACAGG 0: 1
1: 0
2: 0
3: 7
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130550456 Original CRISPR CACAAGGACTTGCCTCTTAC AGG Intronic
900816815 1:4853796-4853818 CACAACGAATTGTCTCTTCCAGG + Intergenic
901029041 1:6295709-6295731 CCCATGGACTTGCCTCTTCTGGG - Intronic
901902996 1:12382540-12382562 CTCAAGAATTTTCCTCTTACTGG + Intronic
902917565 1:19647831-19647853 CACCAGGCCTTTCCTGTTACCGG - Intronic
905574669 1:39034272-39034294 CAAAAGGCCTTTCATCTTACGGG - Intronic
907069017 1:51518278-51518300 CACAAGGACTGGACTTTGACAGG + Intronic
907319102 1:53591774-53591796 CACTTGGTCTTGCCTCTTCCAGG - Intronic
910904445 1:92160463-92160485 CTCATGGACTGGCCTCATACAGG + Intergenic
911187708 1:94919916-94919938 CTCAAGGACTTGCTTCACACAGG + Intronic
912547114 1:110458711-110458733 GACAAGAACTTGCCTCATCCAGG - Intergenic
912783988 1:112581001-112581023 CACCTGGATTTGCCTTTTACTGG + Intronic
912785464 1:112599241-112599263 TACAAGGACCTGTTTCTTACAGG + Intronic
914899604 1:151704775-151704797 TACAAAGACTTGGCTCTTTCTGG + Intronic
917378259 1:174374366-174374388 AACAAGGACTCCCTTCTTACTGG + Intronic
918727342 1:187942322-187942344 CACAAGGTCCTGCCTCCTGCTGG - Intergenic
919630009 1:199951275-199951297 CACATGTAGTTTCCTCTTACTGG - Intergenic
923201619 1:231718146-231718168 CACACGCACTCGCCTCTTAATGG + Intronic
924094057 1:240532974-240532996 CATGAGGACTTGCTTGTTACGGG - Intronic
1063835706 10:10009372-10009394 AAAAGGGAGTTGCCTCTTACTGG - Intergenic
1068006645 10:51398822-51398844 AACAAGGAAATCCCTCTTACTGG - Intronic
1068266528 10:54656903-54656925 CACAAGGGCTGGCCTTTAACTGG - Intronic
1068945309 10:62723658-62723680 CACAAGGAGCTGACTCCTACAGG - Intergenic
1069189606 10:65469566-65469588 CAGAAGGGCTGGCTTCTTACTGG + Intergenic
1069970729 10:72166186-72166208 CATAAGGACTTGCCTCTGGGTGG - Intronic
1071451057 10:85791676-85791698 CACAAGGAATTATCTCTTAGGGG + Intronic
1077164987 11:1130888-1130910 CACCAGGACTTGCTTCCCACAGG - Intergenic
1088361063 11:108990486-108990508 CAGAAGGAGGTCCCTCTTACTGG - Intergenic
1090282221 11:125465886-125465908 CACAAGCCCTTGCCTCTTTACGG + Intronic
1090862417 11:130665899-130665921 CAAAAGAAGTTGCCTCTTCCAGG - Intergenic
1092441850 12:8511551-8511573 GAAAAGGACCTGCCTCCTACAGG + Intronic
1094573321 12:31661274-31661296 CTCAAGAAAATGCCTCTTACAGG - Intronic
1095485340 12:42678714-42678736 CAAAAGGACTTGCCTTGGACAGG - Intergenic
1100369537 12:93954937-93954959 CAGAAGGACTTTCCTCTTCCTGG - Intergenic
1101090243 12:101277899-101277921 CACACTGACTTGACTCTGACTGG - Intergenic
1101663760 12:106790031-106790053 TACAAAGATTTGCTTCTTACCGG + Intronic
1111044899 13:82802169-82802191 CAGGAGGAGTTTCCTCTTACTGG - Intergenic
1112859393 13:103811377-103811399 CAGAATGACTTTCCTCTCACTGG - Intergenic
1116364028 14:44038505-44038527 CACAAGGACTGGCCTCTCCCTGG + Intergenic
1118859845 14:69654275-69654297 CACAAGGCCTGGCATCTGACAGG - Intronic
1120968645 14:90189759-90189781 CAGAAGGGCTTGCCTCTCTCAGG - Intergenic
1127991135 15:64118520-64118542 TAGAAAGACTTGCCTCTTGCAGG - Intronic
1128557077 15:68639164-68639186 CACAAGGAGGTGCCTCCTTCAGG - Intronic
1130550456 15:84887364-84887386 CACAAGGACTTGCCTCTTACAGG + Intronic
1131456119 15:92583880-92583902 CACATGGGCTTGCTTCTTTCTGG + Intergenic
1141229133 16:82148015-82148037 CATAAGAAATTGCCTTTTACAGG - Intronic
1146830310 17:36063355-36063377 CAAGAGGAATTCCCTCTTACAGG - Intergenic
1150237790 17:63607013-63607035 CACCAGGACTGGCATCTTAATGG + Intronic
1151685453 17:75643578-75643600 CACAAGAAGCTGCCTCTTAAAGG - Intronic
1152922765 17:83074014-83074036 GACAAGGCCTTGCCTCCTTCGGG + Intergenic
1154954870 18:21243215-21243237 CACATGGAGTTTCCTCTTAATGG - Intronic
1156973245 18:43183765-43183787 TACAAAGAATTGCCTCTTAAGGG + Intergenic
1157294808 18:46434923-46434945 CACACAGACTCGCCTCCTACAGG - Intronic
1157643193 18:49239080-49239102 CACATGAACATGCATCTTACAGG + Intronic
1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG + Exonic
1162602828 19:11682320-11682342 AACAAGGACATGCCTCTCATTGG - Intergenic
1163483475 19:17572693-17572715 CACAGGGACTTGCATCTGCCTGG - Intronic
1163720120 19:18894806-18894828 CACAAGGGCCAGCCTCTTCCCGG + Intronic
1163994228 19:21028080-21028102 CATAAGGTCTGGCCTCTTCCTGG + Intronic
932824493 2:74927053-74927075 AGCAGGGACTTGCCTCTTCCTGG + Intergenic
934939457 2:98489935-98489957 CACAAGCACTTGGATCCTACAGG - Intronic
945986033 2:216354382-216354404 CACGTGGACTTGCCTTTTAGTGG - Intronic
946809366 2:223507028-223507050 CACAAGGCCTTGACTTTTATGGG + Intergenic
947977935 2:234383986-234384008 CACACTGACTTGCCTCTATCAGG - Intergenic
948556798 2:238817531-238817553 CACATGCACTTTCCTCTTCCTGG + Intergenic
1168825553 20:811148-811170 CACAAGAACTTGCTCCTTAGGGG + Intergenic
1180077459 21:45469965-45469987 CACAACAAATTGCCTCTCACTGG - Intronic
1184211926 22:43041070-43041092 CACCAGGACTTGCTTCCTATGGG + Intronic
951183450 3:19684941-19684963 CTCAGGGACTGGCCTCATACAGG - Intergenic
952668857 3:35941668-35941690 CAAAAGGACTTACCTCTAAGAGG + Intergenic
955873319 3:63462884-63462906 CACAAGCACCTTCCCCTTACAGG - Intronic
956532188 3:70232771-70232793 CACAGGGACTGACTTCTTACTGG + Intergenic
959779760 3:110215788-110215810 CACAAAGAATTGCCTCAGACTGG - Intergenic
961605019 3:128087187-128087209 CACAAGCACTGGCCTCTTCCAGG + Intronic
967204198 3:187104299-187104321 CACAAGGACTTCCCGGTCACAGG - Intergenic
967820193 3:193832932-193832954 CACAAGCAGTTCCCTCTAACTGG - Intergenic
969483277 4:7458135-7458157 CACAAGATCTTCCCTCTTTCCGG - Intronic
995208993 5:109515587-109515609 CACATGGCCTTTCCTCTTTCTGG + Intergenic
1000161000 5:158597668-158597690 CAAAAGGGCTTACCTCTTAATGG + Intergenic
1003740765 6:8935945-8935967 CACAAGAACTTTCCTCCAACAGG + Intergenic
1004223658 6:13767969-13767991 CAGAAGGACTGTCCTCTTACTGG - Intergenic
1004645169 6:17553647-17553669 AACAAGATCTTGCCTCTTACAGG + Intronic
1007292071 6:40795414-40795436 CATAAGGACCTGCCACTTCCTGG - Intergenic
1008459343 6:51750108-51750130 CAAAAGGACTTGCTTCTTCATGG - Intronic
1015255867 6:131178922-131178944 CACTTGAACTTGCTTCTTACAGG + Intronic
1016848160 6:148589788-148589810 AATAAGGAATTGCCTCTTATGGG + Intergenic
1018545433 6:164930367-164930389 CTCAAGGTCTTCCCTCTTCCTGG - Intergenic
1033673911 7:143519267-143519289 CACAAGGAGTTGTCTCTTGTGGG + Intergenic
1035458674 7:159025707-159025729 GACAAGGACTTCCCTCGTAAGGG - Intergenic
1036396149 8:8372939-8372961 AAAAAGGACTTGCTTCATACAGG - Intronic
1038751487 8:30300180-30300202 CACAATGACTTGCCTATCACAGG + Intergenic
1040981096 8:53246891-53246913 AACAAGGAATTGGCTCTTTCTGG + Intronic
1042268387 8:66931649-66931671 GACAAGAACTTTCCTCTTACAGG - Intergenic
1044431928 8:92117777-92117799 TACAAGGAGTTGTCTCTTAAAGG + Intergenic
1048004888 8:130411215-130411237 CACAATGCCTTGACTCTCACAGG + Intronic
1048875216 8:138831739-138831761 CACAGGGACCTTCCTCTTCCTGG + Intronic
1061490366 9:130940762-130940784 AACAAGGACTTGCCTATTGGTGG + Intergenic
1189963943 X:46352569-46352591 CTCAAGGACTTTCCTCTTCTGGG - Intergenic
1199627913 X:149757825-149757847 CTCAAGAACTTGCATCTTGCTGG - Intergenic