ID: 1130572736

View in Genome Browser
Species Human (GRCh38)
Location 15:85062929-85062951
Sequence CCAAAGCCAGAATTTTTATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 299}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130572736_1130572739 4 Left 1130572736 15:85062929-85062951 CCTCATAAAAATTCTGGCTTTGG 0: 1
1: 0
2: 1
3: 25
4: 299
Right 1130572739 15:85062956-85062978 CAGTTACACCAGTATGAGACTGG 0: 1
1: 0
2: 0
3: 9
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130572736 Original CRISPR CCAAAGCCAGAATTTTTATG AGG (reversed) Intronic
900893638 1:5467621-5467643 GCACAGCCAGAATGTGTATGGGG - Intergenic
903350305 1:22712779-22712801 CCAAAGCCAGAGTTAATAAGTGG - Intronic
903723806 1:25425960-25425982 CCAAAGCCAGAATTTGAACCAGG - Intronic
903808071 1:26019578-26019600 CAAATGCCAGCTTTTTTATGAGG + Intergenic
906051141 1:42874037-42874059 CCAAAGCCAGCATAATTAAGGGG - Intergenic
906180434 1:43813477-43813499 GCAAAACCAGAATTATTTTGAGG + Intronic
909118682 1:71572985-71573007 CCAGAGGCAGAATTCTTATTAGG + Intronic
910552655 1:88494001-88494023 CCAAAACCAGATTTATTCTGTGG + Intergenic
911170692 1:94768362-94768384 TCAAAGCCAGAAATTAAATGAGG - Intergenic
913325939 1:117628977-117628999 CCAAAGACATAAGTTTCATGAGG - Intergenic
918911288 1:190574035-190574057 CCAAAGCCAGAAGATAAATGTGG - Intergenic
920546107 1:206819943-206819965 CCAAAGCCTAAGTTCTTATGTGG + Intronic
921990009 1:221355638-221355660 CAAAAGTCCAAATTTTTATGAGG + Intergenic
922028348 1:221774423-221774445 CCATATCCAGAATTCTTCTGAGG + Intergenic
1062793854 10:327418-327440 CCACAGCAAGAACTGTTATGAGG + Intronic
1064157040 10:12910893-12910915 CCAAGGGCAAAATTTATATGTGG + Intronic
1065413895 10:25463367-25463389 CCAAACCCAAAATATTTCTGAGG + Intronic
1066338884 10:34509405-34509427 CCAAAGCCAGTATGTCCATGAGG + Intronic
1066779973 10:38933723-38933745 CAAAACCCAGAATTTTTGGGGGG + Intergenic
1067420154 10:46138123-46138145 CAAAAGGGAGAATTATTATGAGG + Intergenic
1067425865 10:46211397-46211419 CAAAAGGGAGAATTATTATGAGG - Intergenic
1067505500 10:46844611-46844633 CAAAAGGGAGAATTATTATGAGG + Intergenic
1067968816 10:50945346-50945368 CCAAAGTCAGAGTTATTAAGTGG - Intergenic
1067971426 10:50975221-50975243 AGTAAGCCAGAATTTGTATGTGG + Intergenic
1069970483 10:72163738-72163760 CCAGAGCCAAAATTTTTTTTTGG - Intronic
1072350165 10:94549597-94549619 CCAATCCCAGATTTTTTATTGGG - Intronic
1073910306 10:108334781-108334803 CCAAAGGCAGCATTTTGATTTGG - Intergenic
1076307334 10:129474501-129474523 CCAAAGCCAGATCCTTTATCTGG - Intronic
1078581815 11:12544686-12544708 GCAAAGCCAGAATTTGAATCTGG - Intergenic
1078961633 11:16280244-16280266 CAAAATCCAAAATTTTTGTGGGG - Intronic
1079441735 11:20521783-20521805 GCAAACCCAGAGTTTTTCTGTGG - Intergenic
1079826610 11:25202899-25202921 CCAAACCCAGAAATTTATTGTGG - Intergenic
1079851372 11:25540122-25540144 TAAAAGCCAAAATTATTATGTGG + Intergenic
1080747719 11:35123609-35123631 GGAAAGCTAGAAATTTTATGAGG + Intergenic
1080870187 11:36230023-36230045 CTAAAGCCAGAATTTATACAGGG - Exonic
1081024426 11:37992320-37992342 CTGAATCCAGGATTTTTATGGGG + Intergenic
1081912783 11:46710830-46710852 CAAAAGCCAGGATTCTAATGTGG + Intergenic
1082681001 11:56170221-56170243 CAAAAGGAAGAATTTTAATGGGG - Intergenic
1086974926 11:93120785-93120807 GCAAAGGCAGGATATTTATGAGG - Intergenic
1087017384 11:93567294-93567316 CCAAGGCCAGAATATTTGTTTGG + Intergenic
1088751459 11:112845551-112845573 CCAGAGCCAGCATTTAAATGAGG + Intergenic
1088938497 11:114428957-114428979 CCAAAGCCAAACATTTCATGGGG - Intronic
1091953396 12:4614589-4614611 ACAAATACATAATTTTTATGTGG + Exonic
1092014644 12:5148649-5148671 CCATAGCTAGAATCTTTAAGTGG - Intergenic
1092608143 12:10142690-10142712 TCAAAACCAGAATATTTATAGGG + Intergenic
1093003220 12:14023431-14023453 CCAAATCAAGAATTTCTATTTGG + Intergenic
1093980980 12:25475196-25475218 CAAAATCCAGAATTTTCCTGGGG - Intronic
1094002863 12:25715158-25715180 CTAAATCCAGCATCTTTATGAGG - Intergenic
1095246633 12:39930770-39930792 CTGAAGTCAGAATATTTATGTGG - Intronic
1097841691 12:64327691-64327713 CCAATGCCAGCATTTTAAAGGGG + Intronic
1097971429 12:65637319-65637341 CAAAAGCCAGAATATAAATGTGG - Intergenic
1098763693 12:74457486-74457508 CCAAAGCAAGAGATTTTATTTGG - Intergenic
1103261670 12:119593998-119594020 CCAAAGCCACGATGTTGATGGGG - Exonic
1103407968 12:120688890-120688912 CCAAAGCCAGACTTTATAGCAGG + Intronic
1104193395 12:126506285-126506307 TCAAATCCAGAATTTTCATTTGG + Intergenic
1104342505 12:127964063-127964085 GCAAAGCCATAATTTTGCTGGGG + Intergenic
1104486261 12:129153314-129153336 CCAAATGCAGAATTTAAATGTGG + Intronic
1104647781 12:130509298-130509320 CAGCAGCCAGAGTTTTTATGGGG - Intronic
1104649124 12:130518562-130518584 CTAGAGCCAGAGCTTTTATGGGG + Intronic
1106341746 13:28836401-28836423 CCAAAGCTAGAATTTGAATCTGG - Intronic
1106870536 13:34014094-34014116 CCAAGGTCAGATGTTTTATGGGG - Intergenic
1110424567 13:75352351-75352373 CAAGACCCAGAATTTGTATGGGG - Intronic
1111362833 13:87197822-87197844 TCCAAGCTAGAATATTTATGGGG + Intergenic
1112015703 13:95329854-95329876 CCAGAGGCACAATTATTATGGGG + Intergenic
1113162894 13:107402667-107402689 CCAAAGCCTGTATTTTTCAGTGG - Intronic
1115157871 14:30360912-30360934 ACAGAGCCAGAATTTAAATGTGG - Intergenic
1115185231 14:30680480-30680502 CCAAAGCCTGAATTTTAACTTGG + Intronic
1116655174 14:47643785-47643807 CCAAGGCCAGGATTTTTAAATGG + Intronic
1117982717 14:61357849-61357871 CCAAGGCCAGAGTATATATGAGG - Intronic
1119529335 14:75348622-75348644 CCACAGCCAGACACTTTATGAGG + Intergenic
1120242495 14:81965731-81965753 CCAAAGCCAGAATTCTCTTAGGG - Intergenic
1121167806 14:91824086-91824108 CCAATGCCAGAAATGATATGGGG + Intronic
1122288463 14:100666813-100666835 CCAAAGCCAGAATGATGAGGGGG - Intergenic
1124172169 15:27385696-27385718 TCAAATCCAGAATTTTCATTTGG + Intronic
1125115476 15:36086398-36086420 CCAAATCCTGAGATTTTATGGGG - Intergenic
1126987686 15:54331966-54331988 CAAAACTCAGAATTATTATGAGG + Intronic
1129295933 15:74600125-74600147 CCAAGGCCAGGGTTTCTATGAGG - Intronic
1129815499 15:78549369-78549391 ACAAAGCCAGAATTGATGTGTGG + Exonic
1130572736 15:85062929-85062951 CCAAAGCCAGAATTTTTATGAGG - Intronic
1130763579 15:86847093-86847115 TCCACTCCAGAATTTTTATGTGG + Intronic
1134212688 16:12291052-12291074 CTAAAGCCAGACTTTTCCTGAGG - Intronic
1134608672 16:15590674-15590696 CCAGAGGCAGGATTTTGATGAGG - Intronic
1135131820 16:19859727-19859749 CCCAAGCCAGAATATTTCTATGG + Exonic
1135503738 16:23018662-23018684 CCAGAGCCAGAATACTTATAGGG + Intergenic
1138306663 16:55983067-55983089 CCTCATGCAGAATTTTTATGAGG + Intergenic
1138817287 16:60217195-60217217 ACAAAGCTAGGAATTTTATGAGG + Intergenic
1141014589 16:80437144-80437166 CCAAAGCAAGAAGCATTATGGGG + Intergenic
1143232977 17:5373057-5373079 CAAAAGATAGAATTTTTAAGCGG + Intronic
1144140771 17:12345628-12345650 TCAGAGCCAGCATTTTTATCAGG - Intergenic
1144238718 17:13288323-13288345 CAAAAGCCAGAAGTTTAATGGGG - Intergenic
1145709282 17:26954413-26954435 CAAAACCCAGAATTTTTGGGGGG + Intergenic
1148197439 17:45724421-45724443 CAAACCCCAGAGTTTTTATGAGG + Intergenic
1148340205 17:46868848-46868870 CCACACCCAGAATTATTCTGGGG + Intronic
1150750003 17:67852662-67852684 CAAAAGCTGAAATTTTTATGTGG - Intronic
1151455188 17:74221736-74221758 GCAAAGCCAGAATTCTGAGGGGG - Intronic
1153545051 18:6196518-6196540 CCAAAGCCCCAAATTTTAAGAGG - Intronic
1153611180 18:6886905-6886927 CCAAATCCAGAATTATTCTGAGG + Intronic
1154518970 18:15206331-15206353 CAAAACCCAGAATTTTTTGGGGG - Intergenic
1155782526 18:29854879-29854901 CCAAAGCCAGATCTTTTAAAGGG - Intergenic
1156104619 18:33644569-33644591 CCAAAGCCCAAATACTTATGTGG - Intronic
1156131566 18:33982435-33982457 TCAAAGCCAGAAGATTTATCAGG + Intronic
1156952049 18:42913347-42913369 CCAAAGCCACAATTCATAAGAGG + Intronic
1156980361 18:43279608-43279630 CCAAAGCAAGAACTTGTTTGAGG - Intergenic
1157374861 18:47153174-47153196 CTAAAGCAAGGATTTTGATGGGG + Intronic
1157785620 18:50479587-50479609 CCAGAGTCACAATTTTGATGTGG + Intergenic
1164942403 19:32261308-32261330 CCAAGGCGAGGATTTTTGTGTGG + Intergenic
1168123421 19:54268051-54268073 CCAAAGACAAAATTATAATGTGG + Intronic
926948754 2:18218136-18218158 CCAAAGCCTGAGTCTTCATGTGG + Intronic
927878866 2:26676417-26676439 CCATAGCAAGGATTTTCATGGGG - Intergenic
928360821 2:30660993-30661015 CCAAAGCCACACATTTAATGAGG - Intergenic
929450941 2:42036664-42036686 CCAAACCCAGCATCTTTATCAGG - Intergenic
929588730 2:43131905-43131927 CAAACGCCACAATTTTTTTGTGG - Intergenic
930859502 2:56055333-56055355 CCAAACCCACAATATTTCTGAGG - Intergenic
931455241 2:62405001-62405023 CTAAAATCAGAATTTTTTTGAGG - Intergenic
933875826 2:86621342-86621364 CCAAAGCCATCATTTTTTTATGG - Intronic
934014942 2:87870506-87870528 CCAGAGCCAGAGTCTTTATGGGG - Intergenic
934155356 2:89194634-89194656 CCATAGCCAGATTTTTCATGTGG + Intergenic
934211968 2:89988120-89988142 CCATAGCCAGATTTTTCATGTGG - Intergenic
934707607 2:96495302-96495324 CCAACTCCAGAATTTCTATTTGG + Intergenic
936539630 2:113339647-113339669 CCACACACAGAATTTTTATTTGG + Intergenic
937114005 2:119390823-119390845 CTATATCCAAAATTTTTATGAGG + Intergenic
937559190 2:123200057-123200079 CAAAAACCAGAATTTTTCAGGGG + Intergenic
938518974 2:132046878-132046900 CAAAACCCAGAATTTTTGGGGGG - Intergenic
938682073 2:133702240-133702262 TCAAAGCCAAAATTTTTCTGAGG + Intergenic
938888852 2:135682211-135682233 CCAAAGTCATCATTTCTATGTGG + Intronic
939043106 2:137216028-137216050 TCAAAGGCAGAATTTTGTTGAGG + Intronic
939942807 2:148370899-148370921 CCAAAGCAAGAATATAGATGAGG + Intronic
942492312 2:176501747-176501769 GCAATGCCAGGATTTTAATGAGG - Intergenic
944388840 2:199196019-199196041 CCAAAGCCAGAGTTTTTAGAGGG - Intergenic
945500142 2:210562568-210562590 CTAAAGCCAGAATTTATTTCAGG - Intronic
1170692717 20:18629601-18629623 CCAAAGCCAGATTTTTAAAGTGG + Intronic
1171757525 20:29125059-29125081 CCAGAACAAGGATTTTTATGGGG - Intergenic
1171863552 20:30423948-30423970 CCAGAACAAGGATTTTTATGGGG - Intergenic
1173875857 20:46371048-46371070 GCAAAGCCAGGATTTGAATGTGG + Intronic
1173944688 20:46941171-46941193 GCAAAGCCAGGATTTGAATGTGG - Intronic
1175155556 20:56968870-56968892 CCATAACCAAAATATTTATGTGG - Intergenic
1175302797 20:57954783-57954805 CCATACCCAGAGTTTTTATTGGG + Intergenic
1175752130 20:61506047-61506069 CCACATTCAGAATTCTTATGGGG - Intronic
1177380785 21:20341339-20341361 CAAACTCCTGAATTTTTATGTGG - Intergenic
1177650776 21:23959243-23959265 CAAAAACCAGAAGTTTTATTAGG + Intergenic
1177770056 21:25504108-25504130 CTATAGCCACAAGTTTTATGAGG + Intergenic
1178388446 21:32177881-32177903 AAAAAGCCAGGATTTTTATTGGG - Intergenic
1179200936 21:39220084-39220106 CCAAAGTCATAGTTTTTAGGTGG - Intronic
1179456632 21:41505204-41505226 CCAAACCCAGAATTTTCAAGAGG + Intronic
1180280667 22:10690732-10690754 CAAAACCCAGAATTTTTGGGGGG + Intergenic
1180692434 22:17728288-17728310 CCAAAGGCAGCATTTTTACAAGG - Exonic
1180731344 22:17984782-17984804 CCTAACTCAGAATTTTTGTGAGG - Intronic
1181516377 22:23415998-23416020 CCTAACTCAGAATTTTCATGAGG - Intergenic
1181712855 22:24701854-24701876 ACAAAGTCAGAAATTTTAAGGGG - Intergenic
1182274247 22:29175691-29175713 CCAACTCCAGAATTTTCATTTGG + Intergenic
1184068415 22:42133501-42133523 ACAACTCCAGAATTTTTATTTGG + Intergenic
1184298123 22:43539019-43539041 CCAAAGCCAGCAGTGTTAGGTGG + Intronic
1185247038 22:49778517-49778539 ACAAAGTCAGGATTTTTAGGGGG - Intronic
949404487 3:3700053-3700075 GCAGAGCCAGAATTTGAATGTGG + Intergenic
950918881 3:16672639-16672661 CCAAGGGGAGAATTATTATGAGG - Intergenic
951173383 3:19569334-19569356 ACAAAGCCAACATTTGTATGTGG - Intergenic
951403738 3:22268470-22268492 GCAAAGCCAGATTTATTATTTGG - Intronic
953208794 3:40856039-40856061 TCAGAGCCTGAATTTTTATTTGG - Intergenic
953467606 3:43137339-43137361 TCAAATCCAGAATTTCTATTTGG + Intergenic
955451450 3:59071915-59071937 GCCCAGCCAGAATTTTGATGGGG - Intergenic
956324360 3:68034975-68034997 CCAAAGCCAGGATCTTCAGGTGG - Intronic
958927636 3:100176343-100176365 CAAAAACCAGAAATTTTAAGGGG - Exonic
959625704 3:108447045-108447067 TCAATTCCAGAATTTCTATGTGG - Intronic
964145077 3:153450333-153450355 CCAAAGCAATAATTATTGTGTGG - Intergenic
964667119 3:159186983-159187005 CCAATGCCAACATTTTAATGGGG - Intronic
965008025 3:163051123-163051145 CCCAAAACAGCATTTTTATGAGG - Intergenic
966354478 3:179065246-179065268 CAAAAATCAGAATTTTTAAGTGG - Intronic
966558527 3:181291911-181291933 ACCAAGCCAGAATTATTATAAGG + Intergenic
967153768 3:186674049-186674071 CCAAGTCCAGGATTTTTCTGAGG + Intronic
967414128 3:189197953-189197975 CCAAGGCCAGAATGTGTAAGTGG + Intronic
968026354 3:195445785-195445807 GCAAAGGCAGAATTCTTAAGGGG - Intergenic
968043169 3:195605166-195605188 AAAAAGGCAGAATTATTATGAGG - Intergenic
968243056 3:197110318-197110340 CCAACTCCAGAATTTCTATTTGG + Intronic
968723658 4:2227614-2227636 CAAAAGCCAGAATTTTAACGGGG + Intronic
969887950 4:10233187-10233209 CAAATTCCAGAATTTATATGGGG + Intergenic
970265961 4:14286534-14286556 CCAAAGCTAGAGTTTTTTTTTGG - Intergenic
970451519 4:16171127-16171149 CCAAAGCTAGAATTATTTGGTGG + Intronic
970862924 4:20723970-20723992 TCAAAGCCTTCATTTTTATGGGG + Intronic
974058663 4:57010138-57010160 CCATAAACAGAATGTTTATGTGG + Intronic
974233994 4:59156529-59156551 ACAAAGGCAGAATATTTATTTGG - Intergenic
975404852 4:73977310-73977332 CCAAAACCACAATGTTGATGGGG - Intergenic
977298693 4:95241929-95241951 ACAAACCCAGAATTTTCAAGAGG + Intronic
978357214 4:107889973-107889995 AAAAAGGGAGAATTTTTATGAGG + Intronic
979155087 4:117376269-117376291 AAAAAGCCATAATTTTTATATGG - Intergenic
980766337 4:137310454-137310476 TCATAGCCAGGATTTTTATTAGG + Intergenic
981269622 4:142830249-142830271 CCAAAGCAAGAATTTTTCTAAGG + Intronic
982643602 4:157994067-157994089 ACAAAACCAGAATATTTTTGGGG + Intergenic
982889424 4:160828976-160828998 CCAAATGCAGAATGTTTATAAGG + Intergenic
982918734 4:161248536-161248558 CTAAATCCAGAATTTTTGGGGGG - Intergenic
982986413 4:162213083-162213105 CTTAAGTCAGGATTTTTATGGGG + Intergenic
983910966 4:173238749-173238771 CCAAAGCATGAATTTTTATAAGG + Intronic
984075003 4:175165809-175165831 CCAAATCCAGAGTAGTTATGTGG + Intergenic
984303796 4:177960514-177960536 CCAAAGACAAAATTTTCAAGGGG + Intronic
984446455 4:179842759-179842781 CTAAAAGCAGAATTTTTAGGGGG + Intergenic
987534843 5:19171629-19171651 GCAAAGCCAGAATTTGAATGAGG + Intergenic
987823757 5:23001036-23001058 ACAAACCCAGAATATTTCTGCGG + Intergenic
988393595 5:30668178-30668200 CCAAGCTCAGAATTGTTATGAGG + Intergenic
988520986 5:31945563-31945585 CCAAAGACAGAATTTTGGTGTGG - Intronic
988774867 5:34468732-34468754 CCAAAGGGAGAACTATTATGAGG + Intergenic
989372064 5:40721118-40721140 CCAATGCCCCAGTTTTTATGGGG + Intronic
989450280 5:41578533-41578555 CCACTGCCAGCAGTTTTATGGGG + Intergenic
989474237 5:41856311-41856333 CCAAAGCCAGAATTCTGGAGTGG - Intronic
989622416 5:43397490-43397512 CCACAGCCAGAATTAAAATGAGG + Intronic
991204589 5:64035951-64035973 GCAAAGCCAGAATATGGATGTGG - Intergenic
991504123 5:67306406-67306428 ACAAAGAGAGAATTTTGATGGGG + Intergenic
993935182 5:93990837-93990859 AGAAAGCCAGCATGTTTATGGGG - Intronic
994479838 5:100320771-100320793 GGAAAGTCAGAATTTTTAGGAGG - Intergenic
994490045 5:100430061-100430083 GCAAAAACAGAATGTTTATGTGG + Intergenic
994807750 5:104473431-104473453 CCAAAGCCACAATATTTCTGTGG - Intergenic
996478972 5:123951841-123951863 CCAAAACCAGAAGTTATATTTGG + Intergenic
998940456 5:147276617-147276639 CCTAAGCCAGGAATTTTCTGAGG + Intronic
1000383284 5:160648058-160648080 ACAAAGCCAGGACTTATATGGGG - Intronic
1000454315 5:161430261-161430283 CCACAGCCAGGATATCTATGAGG + Intronic
1000565586 5:162843013-162843035 TCAAAGCCAGAATTTAAAGGTGG + Intergenic
1000710716 5:164573135-164573157 CTAAAGCTTGAATTTGTATGGGG + Intergenic
1001245563 5:170103879-170103901 CCAGAGGCAGAATTTTTGTTTGG - Intergenic
1002671254 5:180869375-180869397 CAACAGCGAGAAATTTTATGGGG + Intergenic
1002934606 6:1661020-1661042 CCCAAGCCACATCTTTTATGTGG - Intronic
1003790738 6:9544571-9544593 CTAAAGTCAGACTTTTTAAGAGG + Intergenic
1004573232 6:16868267-16868289 CCAAAGCCAAAATTATCTTGTGG + Intergenic
1004851403 6:19703374-19703396 CCAAAGCCAATATTATTAAGGGG - Intergenic
1005075838 6:21906393-21906415 CCAATGCCACAATTTTAAGGGGG - Intergenic
1005092561 6:22073069-22073091 ACAAAGCCAGCATTTTGAGGAGG + Intergenic
1006708017 6:36038688-36038710 CCAGAGCCAGTATTTTTGTTGGG + Intronic
1007749587 6:44063814-44063836 CCAAAGCCATCATTTCTGTGGGG - Intergenic
1007844024 6:44739187-44739209 CCAAAGCAATAATTTTTACCCGG - Intergenic
1008069528 6:47085539-47085561 CCAGATCCAGAATTTTTAAGGGG - Intergenic
1009609696 6:65925152-65925174 AAAAATCCAGAATTATTATGAGG - Intergenic
1011245693 6:85318802-85318824 CCAAAGTCCTAATTTTTATCTGG - Intergenic
1013576848 6:111491959-111491981 CCAAAGTCAGATTTATCATGTGG + Intergenic
1014718068 6:124888549-124888571 CCAATTCCAGAATTTCTATCTGG + Intergenic
1017360394 6:153562835-153562857 ACAAAGACAGCATTTTCATGTGG - Intergenic
1017480122 6:154845132-154845154 CCTAAGCCATAATTGTTCTGTGG - Intronic
1017647180 6:156550385-156550407 CCAAAGACAGAATATGTGTGTGG + Intergenic
1017932438 6:158969827-158969849 TCAATGCCAGAATTTCTATTTGG + Intergenic
1018492593 6:164309544-164309566 TCAAATCCAGAATTTCTATTTGG - Intergenic
1020516025 7:9120451-9120473 CCACAGCTTGAATTTTAATGAGG + Intergenic
1021141081 7:17026346-17026368 CCATGGACAGTATTTTTATGTGG + Intergenic
1021510181 7:21426569-21426591 CCAAGGCCAGTATTTACATGTGG + Intergenic
1022457371 7:30569859-30569881 CCAAAAAGAGAATTATTATGAGG - Intergenic
1022537011 7:31104636-31104658 CCAAAGCTAGAATGTATCTGTGG + Intronic
1022838750 7:34142290-34142312 CCAAAGTCAGCACTTTTAAGTGG - Intronic
1023183331 7:37508553-37508575 CTAAAACCAGAATTTCCATGAGG - Intergenic
1025838108 7:65114965-65114987 CAAAACCCAGAATTTTTGGGGGG + Intergenic
1025879166 7:65518118-65518140 CAAAACCCAGAATTTTTTGGGGG - Intergenic
1025884964 7:65581008-65581030 CAAAACCCAGAATTTTTGGGGGG - Intergenic
1025974146 7:66356379-66356401 CCACACCCAGCATTTTTATTGGG + Intronic
1027331187 7:77095713-77095735 AAAAACACAGAATTTTTATGTGG + Intergenic
1027732130 7:81887697-81887719 TCAAAGCCAGAATTTGAATGGGG - Intergenic
1027770215 7:82397158-82397180 CAAAAGCCAGAATCCTTTTGGGG - Intronic
1027990110 7:85347692-85347714 CCAAGACCAGAATTATTTTGGGG + Intergenic
1028034472 7:85963851-85963873 CCCAAACCAGTATCTTTATGAGG + Intergenic
1028064444 7:86364808-86364830 CCAAAGGCAGAATCTTTAGAGGG + Intergenic
1029097310 7:98098300-98098322 TCAACTCCAGAATTTTTATTGGG + Intergenic
1029245568 7:99197645-99197667 CCAATTCCAGAATTTGTATCTGG - Intronic
1029880519 7:103804286-103804308 ACAAAGCCAAAATATTAATGAGG + Intronic
1031340203 7:120590664-120590686 CCAAAGCCACATCTTTTGTGAGG + Intronic
1033930383 7:146512316-146512338 CCAAACCCAAAATTAGTATGAGG - Intronic
1035273723 7:157734996-157735018 TCACAGCCAGAATTTGTTTGGGG - Intronic
1035651412 8:1268440-1268462 CCAAAGAGAGAAATTTAATGTGG + Intergenic
1037019024 8:13945036-13945058 CAAAAGCCAAAAATTTTATCTGG + Intergenic
1037391220 8:18393791-18393813 CCAAATCCTGAATTTTTTTCTGG - Intronic
1037996668 8:23357398-23357420 TCAAAAGCAGAATTTTCATGGGG - Intronic
1039229987 8:35434358-35434380 CCAAAGTGAGAATTTTTTTTGGG + Intronic
1041289527 8:56295947-56295969 ACAAATTCAGAATTTTTCTGTGG + Intergenic
1041706240 8:60849231-60849253 CCAAAGTCATAATATTAATGAGG + Intronic
1042333152 8:67603955-67603977 TGAAAGGCAGAATTTGTATGTGG + Intronic
1043121721 8:76333612-76333634 CCAAAGCCAAACTTTTTATCTGG - Intergenic
1043796298 8:84546016-84546038 CCAAAGTCAGAATTTTAATGTGG - Intronic
1044085117 8:87934622-87934644 CCACAGGCAGGATTTTTTTGTGG + Intergenic
1045541575 8:103091519-103091541 CCAAACCCATAATATTTCTGAGG - Intergenic
1045568560 8:103346305-103346327 ACAAAGCCAGAATCTTAAAGTGG + Intergenic
1045667619 8:104506619-104506641 CCACAGCCTGAATTTATATGGGG - Intronic
1046766701 8:118077111-118077133 CCAAGTCCAGAATTTCTAGGAGG + Intronic
1047650229 8:126912569-126912591 ACATAGCCAGTATTTTGATGGGG + Intergenic
1048552282 8:135444714-135444736 CCAAAGCCCAAAGTTCTATGTGG + Intergenic
1048576274 8:135692653-135692675 CCAAAGCCAGCATTTTCATATGG - Intergenic
1048932239 8:139324393-139324415 CCAAAGCCTGCATTTAGATGAGG + Intergenic
1049985438 9:946591-946613 CAAAAGCCAGCGTTTTTATGTGG - Intronic
1051086955 9:13360895-13360917 ACAAAAACAAAATTTTTATGGGG + Intergenic
1051131916 9:13871947-13871969 CCAAACCCAGAATTATTAGATGG - Intergenic
1051477114 9:17520017-17520039 CGAAAGCTAGGATTTTTATCAGG + Intergenic
1052242455 9:26291027-26291049 TCAACTCCAGAATTTTTATTTGG - Intergenic
1052457863 9:28723826-28723848 CCAAAGTCAGTTTTTTTAGGAGG - Intergenic
1052488604 9:29133807-29133829 CAAAAGACAGAATTTTTTAGAGG + Intergenic
1052490902 9:29166338-29166360 CTTAAGCCAGAATATTTAGGTGG + Intergenic
1052527808 9:29642210-29642232 CCAAAGGCACAATTTATAAGAGG + Intergenic
1053573622 9:39335484-39335506 CAAACGCAAGAATTTTTCTGGGG + Intergenic
1053624833 9:39858745-39858767 CAAATGCAAGAATTTTTCTGGGG + Intergenic
1053748457 9:41225450-41225472 CCAGAACAAGGATTTTTATGGGG - Intergenic
1053838243 9:42164043-42164065 CAAACGCAAGAATTTTTCTGGGG + Intergenic
1053880036 9:42584483-42584505 CAAATGCAAGAATTTTTCTGGGG - Intergenic
1053892628 9:42709826-42709848 CAAACGCAAGAATTTTTCTGGGG + Intergenic
1054095189 9:60894168-60894190 CAAACGCAAGAATTTTTCTGGGG + Intergenic
1054116657 9:61170093-61170115 CAAACGCAAGAATTTTTCTGGGG + Intergenic
1054123522 9:61283525-61283547 CAAATGCAAGAATTTTTCTGGGG - Intergenic
1054219063 9:62391953-62391975 CAAATGCAAGAATTTTTCTGGGG - Intergenic
1054231653 9:62517216-62517238 CAAATGCAAGAATTTTTCTGGGG + Intergenic
1054337939 9:63825111-63825133 CCAGAACAAGGATTTTTATGGGG + Intergenic
1054591100 9:67012468-67012490 CAAACGCAAGAATTTTTCTGGGG - Intergenic
1055351614 9:75394733-75394755 CCTAATACAGTATTTTTATGAGG - Intergenic
1055462406 9:76531298-76531320 CCAAACCCAGATTTTTTGTGTGG + Intergenic
1055820591 9:80257712-80257734 CCAATGACAAAATTTTTATACGG - Intergenic
1056259659 9:84835127-84835149 CCAAATCCAGACGTTTTATCTGG + Intronic
1056586474 9:87930723-87930745 CCAAAGCCCAAAGTTTTATCTGG + Intergenic
1056610405 9:88122219-88122241 CCAAAGCCCAAAGTTTTATCTGG - Intergenic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1059535031 9:115072681-115072703 CCAAAGTCAGCATTGTTATGTGG - Intronic
1059548653 9:115205071-115205093 ACAAAGCCTGATTTTTTATATGG - Intronic
1060416963 9:123437534-123437556 CCAAGGCGAGGATTTTTTTGAGG + Intronic
1202784587 9_KI270718v1_random:36162-36184 CCAGAACAAGGATTTTTATGGGG - Intergenic
1203581916 Un_KI270746v1:15023-15045 CAAAACCCAGAATTTTTTGGGGG + Intergenic
1186742898 X:12536824-12536846 CCAGAGCCAGAATTAGCATGAGG + Intronic
1186953472 X:14654532-14654554 CCAAACCCACAATATTTCTGAGG + Intronic
1189549830 X:42081445-42081467 CCAAAGGTAGATTTTTTATGGGG + Intergenic
1193245331 X:79221673-79221695 ACAGAGCCACAATTTTTATTTGG - Intergenic
1194074669 X:89374681-89374703 TCAAAGCCAGAACATATATGAGG - Intergenic
1194100289 X:89694715-89694737 CCAAACCCACAATATTTCTGAGG - Intergenic
1194725794 X:97395333-97395355 GTAAAGCCAAAATTTTTTTGTGG - Intronic
1195893416 X:109720433-109720455 TTAAGGCCAGGATTTTTATGTGG - Intronic
1197961258 X:132008599-132008621 CCCAGCCCAGAATTTTTATAGGG + Intergenic
1199129538 X:144168005-144168027 CCAGAGCCAGAGTCTTTATGGGG + Intergenic
1199309005 X:146300695-146300717 CCAAAACCACAGTTCTTATGTGG - Intergenic
1199389739 X:147264852-147264874 CCAAAGACAGCAGTTTTATTGGG - Intergenic
1200453292 Y:3356074-3356096 CCAAACCCACAATATTTCTGAGG - Intergenic
1200730271 Y:6728831-6728853 TCAAAGCCAGAACATATATGAGG - Intergenic