ID: 1130573638

View in Genome Browser
Species Human (GRCh38)
Location 15:85071262-85071284
Sequence TAGAGCAACTCCAGCATCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130573638_1130573640 18 Left 1130573638 15:85071262-85071284 CCTGGGATGCTGGAGTTGCTCTA 0: 1
1: 0
2: 2
3: 7
4: 192
Right 1130573640 15:85071303-85071325 TGAGCCCCAGCAGAGCAGCAAGG 0: 1
1: 1
2: 2
3: 53
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130573638 Original CRISPR TAGAGCAACTCCAGCATCCC AGG (reversed) Intronic
900409495 1:2506321-2506343 TAGAGCTCCCCCAGCACCCCAGG - Intergenic
900500906 1:3004106-3004128 CACAGCTCCTCCAGCATCCCAGG + Intergenic
901025932 1:6278762-6278784 TAGGGATACTCCAGCCTCCCCGG - Intronic
901738226 1:11325702-11325724 CAGTGCAACTTCAGCCTCCCAGG - Intergenic
903301023 1:22378924-22378946 TTGAGCACCTACAGCATGCCAGG - Intergenic
903581245 1:24372556-24372578 AAGAACAAAGCCAGCATCCCTGG - Intronic
905182209 1:36174634-36174656 TAGAGAAACTACAGCTTTCCTGG - Intronic
906065327 1:42976364-42976386 TCGTGCAACCTCAGCATCCCTGG - Intergenic
909110071 1:71464027-71464049 TAAAGTAACAGCAGCATCCCAGG - Intronic
917400412 1:174642858-174642880 CATTGCAACTTCAGCATCCCAGG + Intronic
918177696 1:182060029-182060051 AAGAGCAGCTGCAGCATCCTGGG + Intronic
919390464 1:196977606-196977628 TAAAGCAACACCACCATCACTGG + Exonic
919793053 1:201304678-201304700 TACAGAAACTCTAGCATCTCTGG - Intronic
920547195 1:206828079-206828101 TAGAGGAACTCCTGCTTACCAGG + Intronic
921032723 1:211347773-211347795 AAGAGCTGCTCCAGCACCCCAGG - Intronic
922718937 1:227890593-227890615 GAGTGCAGCTGCAGCATCCCAGG + Intergenic
923460435 1:234205493-234205515 AAGTACAACTCCAGCATTCCTGG - Intronic
1066331320 10:34426762-34426784 AAGAGCAATCCCAGAATCCCAGG + Intronic
1066988879 10:42493505-42493527 TAAAGCAACTCCAGCTACCGTGG - Intergenic
1067478788 10:46582464-46582486 TAGAGCAACTACTGAATGCCAGG + Intronic
1067615951 10:47759337-47759359 TAGAGCAACTACTGAATGCCAGG - Intergenic
1068078626 10:52290996-52291018 TACTGCAACCCCTGCATCCCAGG + Intronic
1068886231 10:62099671-62099693 TATAGCAGTTCCACCATCCCAGG - Intergenic
1070458170 10:76638613-76638635 TAGTTCAACTGCAGCATTCCCGG + Intergenic
1070771420 10:79084754-79084776 TCAAGCAACTCCAGAATCCTAGG + Intronic
1072297114 10:94020123-94020145 TAGAGCAACTGCAACATTGCTGG - Intronic
1074694257 10:116033761-116033783 TCTAGCAACTCCAGCTTTCCTGG + Intergenic
1075485316 10:122817729-122817751 GAGAGCATTTCCATCATCCCAGG + Intergenic
1075672630 10:124272975-124272997 TGGAGCAACTCCAGTCTCTCTGG + Intergenic
1075922274 10:126223886-126223908 TAGAGCCATCCCAGCATCCCTGG + Intronic
1080398440 11:31911658-31911680 AAGAGCAACTACAGTATCACAGG - Intronic
1081296254 11:41393278-41393300 TTGAGCAACCCCAGCATCTATGG - Intronic
1082778820 11:57270294-57270316 CAGAGCATCTCCATCATCACAGG + Intergenic
1084549146 11:69830626-69830648 TACAGCAGCTGCAGCTTCCCAGG + Intergenic
1084986124 11:72873795-72873817 TGAGGCAGCTCCAGCATCCCGGG + Intronic
1086010852 11:82101606-82101628 TACTGCAACTCCCGCCTCCCGGG - Intergenic
1087154074 11:94884046-94884068 TGCAGCAAGTCCAGCTTCCCTGG - Intergenic
1089763604 11:120746981-120747003 TAGAGCAAGCCCATCGTCCCTGG - Intronic
1090429328 11:126633014-126633036 TAGAGCAACCTCTGCCTCCCAGG - Intronic
1090917765 11:131181085-131181107 TTTGGCAACTCCAGCATCACTGG + Intergenic
1091788800 12:3259312-3259334 TAGAGCATCACCAGGATCCTGGG - Intronic
1092079363 12:5701614-5701636 TAAAGCAATTCCAGTATCTCTGG + Intronic
1093527409 12:20118031-20118053 TAGAGCAATTCCACTATTCCAGG - Intergenic
1093642028 12:21538869-21538891 TAGAGTAAGTTCAGCACCCCAGG - Intronic
1093885232 12:24451839-24451861 TAGAGTAGCTACAGCGTCCCAGG - Intergenic
1097672992 12:62563086-62563108 GAGTGCAACTCCGGCAGCCCCGG - Intronic
1097766921 12:63536483-63536505 TAGAGTAAATCTAGCATCCATGG - Intergenic
1099254170 12:80295250-80295272 TACTGCAACTTCAGCCTCCCAGG + Intronic
1101320520 12:103669326-103669348 TAGAGCCAGTCCAGCACCCAGGG + Intronic
1105469412 13:20679348-20679370 CAGAGCAACTCCAGCTACCACGG + Intronic
1113048680 13:106184805-106184827 CAGAGATACTCCTGCATCCCCGG + Intergenic
1117780205 14:59224159-59224181 TAGATCAACAGCAGCATACCAGG + Intronic
1119155402 14:72405541-72405563 TAAAGCAATTCCATCTTCCCAGG + Intronic
1121955190 14:98207086-98207108 AAGACCAACCCCAGCACCCCTGG + Intergenic
1122767650 14:104082869-104082891 TGGAGCAAAGCCAGCATGCCAGG - Intergenic
1122907483 14:104808450-104808472 CAGAGCACCCCCAGCCTCCCTGG + Intergenic
1123753758 15:23380333-23380355 TACTGCAACCCCAGCCTCCCGGG - Intergenic
1124386068 15:29209059-29209081 TAAAACATCTCCAGCATCCCCGG - Intronic
1125797394 15:42413005-42413027 TAGAGCTGCTCCAGCACCCTTGG - Exonic
1129508737 15:76104425-76104447 TAGAACATTTCCATCATCCCAGG + Intronic
1129625837 15:77198385-77198407 GGGAGCACCTCCAGCATCACTGG - Intronic
1130573638 15:85071262-85071284 TAGAGCAACTCCAGCATCCCAGG - Intronic
1131550400 15:93352158-93352180 GAGAGCAGTTCCAGCATCGCAGG - Intergenic
1132393744 15:101457438-101457460 GAGAGCAGCCCCAGCCTCCCAGG + Intronic
1132803446 16:1765157-1765179 CTGTGCATCTCCAGCATCCCCGG + Exonic
1132835341 16:1950214-1950236 CAGAGCACCTCCTGCATACCAGG + Intronic
1133917607 16:10123247-10123269 TAGGGACACTCCAGCAACCCTGG + Intronic
1134177288 16:12017979-12018001 CACTGCAACCCCAGCATCCCGGG + Intronic
1134234578 16:12455347-12455369 TTGAGAACCTCCAGCATTCCTGG + Intronic
1134895159 16:17879676-17879698 TAGAGTACCTCCAGTATGCCAGG - Intergenic
1136619124 16:31416342-31416364 GAGAGCAGCACAAGCATCCCAGG - Intronic
1137567077 16:49539976-49539998 TAGAGCGGCTCCTGCATCCTGGG - Intronic
1139821144 16:69722237-69722259 TACAGCAACTTCTGCCTCCCGGG + Intronic
1141613462 16:85197097-85197119 TTGAGCACCTCCTGCATGCCAGG + Intergenic
1146581571 17:34043171-34043193 TACCGCATCACCAGCATCCCTGG - Intronic
1148871198 17:50659587-50659609 TGGAGCAACTACTCCATCCCAGG + Intronic
1151850238 17:76685629-76685651 TGCAGCAAATCCCGCATCCCTGG - Intronic
1152557182 17:81059197-81059219 TCGAGAAACTCCAGCCGCCCGGG - Intronic
1152773271 17:82183878-82183900 TTGAGCAATTTGAGCATCCCAGG + Exonic
1153631982 18:7079466-7079488 TTGGGCAACTCCAGCTTACCTGG + Intronic
1155474254 18:26222260-26222282 TAGAGCAACACAGGCATCACTGG - Intergenic
1156880873 18:42077908-42077930 TAGAGTAACTCCATGATCCATGG + Intronic
1157187785 18:45555033-45555055 TTGAGCAACTACTACATCCCTGG - Intronic
1159788068 18:72739337-72739359 TAGGCAAACTCCAGAATCCCAGG - Intergenic
1162247836 19:9417294-9417316 TACTGCAACTTCAGCCTCCCGGG - Intronic
1162822853 19:13233944-13233966 TTGAGCACCTACAGCATGCCAGG - Intronic
1162884178 19:13683894-13683916 TACAGCAACTGCCGCCTCCCAGG - Intergenic
1163122882 19:15228397-15228419 TTGAGCAACTACTGCATGCCAGG + Intronic
1164632286 19:29769475-29769497 TAGGGCAAATCCAGAATCCCAGG + Intergenic
925969053 2:9094312-9094334 TAGAGCAGCTCAAGCAACCCAGG + Intergenic
925987178 2:9225928-9225950 TAGAGCAACTGCTCCATACCAGG + Intronic
926310905 2:11675627-11675649 TAGAGCAGCTCTCACATCCCTGG - Intergenic
929610895 2:43269962-43269984 TGGAGGAACTCCAGCAACACTGG - Intronic
931633425 2:64321408-64321430 GAGAGCAAATCCAGGAGCCCTGG - Intergenic
931968016 2:67554915-67554937 GTCAGCAACTCCAGCATCACGGG + Intergenic
937211715 2:120277064-120277086 TAGAGCAACTCCAGTATTATGGG - Intronic
937256721 2:120561036-120561058 TAGAGCAAGGCCAGAGTCCCAGG + Intergenic
938224588 2:129604992-129605014 CAGAGCAACTCCACCAAACCAGG + Intergenic
941059285 2:160827342-160827364 TAGAGCAGCTGCAACATCCCTGG + Intergenic
942533810 2:176941754-176941776 TGAGGCAACTCCAGCACCCCGGG - Intergenic
945628215 2:212237706-212237728 TAGATAAACTCCCACATCCCTGG - Intronic
946178894 2:217938234-217938256 CAGAGCAACCCCAGCCTCCCTGG + Intronic
947080133 2:226386948-226386970 TACTGCAACTCCTGCCTCCCAGG + Intergenic
947271533 2:228341705-228341727 TACAGCACCTCCAGAATCTCTGG - Intergenic
948519177 2:238524708-238524730 ATGACCAACTCCAGCCTCCCGGG - Intergenic
1170960045 20:21017521-21017543 TGAAGGAATTCCAGCATCCCTGG - Intergenic
1172663911 20:36586089-36586111 GAGAGCAGCTCCTACATCCCTGG - Intronic
1173619003 20:44422375-44422397 TTGAGCACCTCCTGCATGCCAGG - Intronic
1174586694 20:51614374-51614396 TACAGCAACTTCTGCCTCCCAGG + Intronic
1175171927 20:57086732-57086754 TGGGGCATCTGCAGCATCCCTGG - Intergenic
1175995103 20:62808468-62808490 CAGAGGGACTCCAGGATCCCCGG + Intronic
1178938976 21:36889100-36889122 TGGAGCAACTCCTGTATGCCAGG - Intronic
1179192540 21:39135724-39135746 TTGAGCCCCTGCAGCATCCCGGG + Intergenic
1181364455 22:22364328-22364350 TGGAGCAACCCCTGCCTCCCTGG - Intergenic
1181498595 22:23302398-23302420 TAGAGAAGCCGCAGCATCCCGGG - Intronic
1182002681 22:26933587-26933609 TTGAGCACCTCCTGCATCCAGGG - Intergenic
1182033830 22:27181848-27181870 TAGAGCACCTACTGCATGCCAGG + Intergenic
1183250875 22:36729554-36729576 TCGAGTAGCTCCAGCTTCCCAGG + Intergenic
1183293387 22:37016443-37016465 AGGAGGAACTTCAGCATCCCGGG + Intronic
1185176839 22:49332656-49332678 CAGAGCAACCCCAGCTTCACAGG - Intergenic
949184720 3:1176339-1176361 CACAGCAACTTCTGCATCCCAGG - Intronic
952123451 3:30272019-30272041 CAGAGCCACTGCAGCTTCCCAGG - Intergenic
953768294 3:45760558-45760580 TAGACCAGCTCCAGCAGGCCAGG - Intronic
956025977 3:64983604-64983626 TAGAGTGTCCCCAGCATCCCTGG - Intergenic
961426730 3:126854369-126854391 GAGAGCACCTCCAACATCTCAGG + Intronic
963432010 3:145219590-145219612 TAGAGCAAATTCAGCATCCCTGG + Intergenic
963508093 3:146213405-146213427 TACTGCAACTTCTGCATCCCGGG + Intronic
964249141 3:154690445-154690467 TCCAGCAACTCTAGCATCCTGGG - Intergenic
964805467 3:160605288-160605310 TAGAGCACCACCAGCTTTCCTGG - Intergenic
966415725 3:179687581-179687603 TACCGCAACTTCAGCCTCCCAGG - Intronic
966601340 3:181778258-181778280 AGGAGCAACTCCAGCTTGCCTGG - Intergenic
969219735 4:5751934-5751956 GAGATCAAGTCCAGCACCCCAGG - Intronic
975020844 4:69486219-69486241 TACAGAAAATGCAGCATCCCTGG + Intronic
976137887 4:81958623-81958645 CAGATCATCACCAGCATCCCTGG - Intronic
976618402 4:87101597-87101619 CAGAGCACATCCAGAATCCCAGG - Intronic
983115647 4:163812680-163812702 TACTGCAACTCCCGCCTCCCAGG - Intronic
985668361 5:1193442-1193464 TAGATGATGTCCAGCATCCCTGG + Intergenic
985906397 5:2840854-2840876 TGGAGCAACCCCAGCACCCGTGG + Intergenic
989417911 5:41202038-41202060 TAGAGGAGCTCCAGCATGGCTGG - Intronic
990211821 5:53488546-53488568 TAAAGCATCTGTAGCATCCCAGG - Intergenic
990763506 5:59156629-59156651 TAGAGCAGCCACAGCAGCCCTGG + Intronic
991303981 5:65157138-65157160 GAGAACCACTCCAGCATGCCTGG - Intronic
991666563 5:69005631-69005653 CTGAGAAACTCCAGGATCCCTGG - Intergenic
992152491 5:73918975-73918997 TATATCAAGTCCAGTATCCCAGG - Intronic
992795281 5:80250415-80250437 CACAGCAACTTCAGCCTCCCAGG + Intronic
995476332 5:112552198-112552220 AAGAGCAAGTGCAGCAGCCCTGG + Intergenic
999202595 5:149826764-149826786 TAGAGCGTCTCCACCATCCAGGG - Exonic
999414941 5:151386953-151386975 TAGAGCAAGTGCAACATTCCAGG - Intergenic
1000026223 5:157361464-157361486 TGGAAGAACTCCAGGATCCCTGG - Exonic
1000209707 5:159098082-159098104 TACATCATCTCCAGCTTCCCTGG - Intronic
1002367104 5:178722140-178722162 TTGAGGAACTCCAGCATTTCAGG - Intronic
1003358248 6:5396270-5396292 TTGAGCAACTTTAGCATCACTGG - Intronic
1006519142 6:34561495-34561517 TCCAGCAACTGCAGCATGCCAGG + Intergenic
1006661276 6:35647580-35647602 TAGAGCTTCTCCAGGCTCCCTGG - Intronic
1008097056 6:47349676-47349698 TCGAACATCTCCATCATCCCAGG - Intergenic
1008393176 6:50976762-50976784 TGGAGCCACTATAGCATCCCTGG - Intergenic
1008816207 6:55569840-55569862 GAGAACAAGGCCAGCATCCCAGG - Intronic
1011404540 6:87004416-87004438 TTGAGCCATTCTAGCATCCCAGG - Intronic
1011702335 6:89967403-89967425 TAAAACACCTACAGCATCCCGGG + Intronic
1012762828 6:103323736-103323758 TTGAGCAAATCTTGCATCCCTGG - Intergenic
1014317123 6:119881939-119881961 TAAAGCATTTCCATCATCCCTGG + Intergenic
1016479271 6:144464574-144464596 TACTGCAACTTCAGCCTCCCGGG + Intronic
1017842796 6:158235089-158235111 TACAGCAACCTCAGCCTCCCGGG - Intronic
1018373309 6:163187728-163187750 GGGAGGAACCCCAGCATCCCAGG + Intronic
1018470844 6:164096566-164096588 AACAGAAACTCCAGCCTCCCTGG - Intergenic
1018672474 6:166191244-166191266 TGGAGCCACACCAGCATGCCCGG + Intergenic
1018865775 6:167746139-167746161 AGGAGCAGCTCCAGCAGCCCAGG + Intergenic
1019729159 7:2620931-2620953 CAGTGCATCTCCAGCCTCCCAGG - Intergenic
1021847878 7:24780111-24780133 GAGGCCATCTCCAGCATCCCTGG + Intergenic
1022423903 7:30249339-30249361 TACCCCAACTCCAGCATTCCTGG - Intergenic
1025997465 7:66537084-66537106 CAGGGCAGCTCCAGCATGCCTGG - Intergenic
1026787359 7:73310260-73310282 TACTGCAACCCCAGCCTCCCAGG - Intergenic
1026990341 7:74581559-74581581 CAGGGCAGCTCCAGCATGCCCGG - Intronic
1029550850 7:101236395-101236417 CAGAGCAGCTCCAACATCCCCGG + Intronic
1031050036 7:116935627-116935649 TTGAGCAACTGCAGGAGCCCTGG + Intergenic
1031833872 7:126658679-126658701 TAGAGCACATACATCATCCCTGG - Intronic
1033710051 7:143933739-143933761 CAGAGCAAAGACAGCATCCCAGG - Intergenic
1034645539 7:152643444-152643466 TAGTGCAACTTCCGCCTCCCGGG + Intergenic
1035314794 7:157991090-157991112 TGGAGCATATCCAGCAGCCCTGG - Intronic
1039269946 8:35869471-35869493 CAGAGCAAATCCTTCATCCCTGG + Intergenic
1039646424 8:39289621-39289643 TGGAGCAACAGCAGCAGCCCAGG - Intergenic
1042019327 8:64354047-64354069 TGGAGCAATTCCAGGATCCTGGG - Intergenic
1042377556 8:68071851-68071873 TAGTGCAAATCCAGCCTTCCTGG + Intronic
1043261536 8:78205766-78205788 GAAAGCAACCCCAGCTTCCCTGG - Intergenic
1043576241 8:81661109-81661131 TAAAGCAACAACAGCATGCCAGG + Intronic
1043840871 8:85102864-85102886 TTGAACAATTCCTGCATCCCTGG + Intergenic
1044567822 8:93684158-93684180 TCTAACAACTCCAGCATTCCTGG + Intergenic
1044622101 8:94200694-94200716 CAGAGCAAGCCCAGCAGCCCTGG - Intronic
1044912181 8:97071928-97071950 TAGAGCAACTGCAGCCATCCTGG - Intronic
1048054916 8:130854194-130854216 TAGAGCCACTCAGGCATCCAGGG + Intronic
1050078659 9:1891608-1891630 CAAAGCAACACCAACATCCCTGG + Intergenic
1054822303 9:69535267-69535289 TAGAGGAAATACAGAATCCCAGG - Intronic
1055646093 9:78362693-78362715 TCAAGCTACTCCTGCATCCCAGG - Intergenic
1055905240 9:81285966-81285988 TTGAACCACTCCTGCATCCCTGG + Intergenic
1057561809 9:96133722-96133744 TAGCCCACCTCCAGCTTCCCAGG + Intergenic
1186374004 X:8979222-8979244 TAGAACAAGCCCTGCATCCCAGG + Intergenic
1193091499 X:77498383-77498405 TTGAACAACCCCTGCATCCCAGG - Intergenic
1195564225 X:106323305-106323327 TAGAACAACTCCAGCAGCCCTGG + Intergenic
1195980128 X:110568567-110568589 TAGATTTGCTCCAGCATCCCAGG + Intergenic
1199254379 X:145701496-145701518 CACAGCAACTTCTGCATCCCGGG - Intergenic
1201865724 Y:18651890-18651912 TGGAGCAACTCCTGTATCACAGG - Intergenic
1202587718 Y:26449412-26449434 TACTGCAACTTCAGCCTCCCAGG - Intergenic