ID: 1130574718

View in Genome Browser
Species Human (GRCh38)
Location 15:85081652-85081674
Sequence CCATGCCCTGTGGGATCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 189}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130574710_1130574718 -1 Left 1130574710 15:85081630-85081652 CCTGGACCTGATTCTTCACCCTC 0: 1
1: 0
2: 1
3: 18
4: 216
Right 1130574718 15:85081652-85081674 CCATGCCCTGTGGGATCCTTGGG 0: 1
1: 0
2: 4
3: 22
4: 189
1130574711_1130574718 -7 Left 1130574711 15:85081636-85081658 CCTGATTCTTCACCCTCCATGCC 0: 1
1: 0
2: 2
3: 30
4: 271
Right 1130574718 15:85081652-85081674 CCATGCCCTGTGGGATCCTTGGG 0: 1
1: 0
2: 4
3: 22
4: 189
1130574709_1130574718 0 Left 1130574709 15:85081629-85081651 CCCTGGACCTGATTCTTCACCCT 0: 1
1: 1
2: 0
3: 14
4: 211
Right 1130574718 15:85081652-85081674 CCATGCCCTGTGGGATCCTTGGG 0: 1
1: 0
2: 4
3: 22
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130574718 Original CRISPR CCATGCCCTGTGGGATCCTT GGG Intronic
902679652 1:18033999-18034021 GGATGCCCTGAGGGAACCTTGGG - Intergenic
903804706 1:25997003-25997025 CCATTCCCTCTGGGCTCCTCTGG - Intronic
904000593 1:27336337-27336359 CCCTGCTCTGTGGATTCCTTTGG + Exonic
904562910 1:31410733-31410755 CCATGCCCCATGCCATCCTTGGG - Intronic
904945773 1:34197742-34197764 CTCAGCCCTGTGGGCTCCTTGGG - Exonic
905544351 1:38785983-38786005 CCATTCCCATTGGGATCCCTGGG - Intergenic
905635351 1:39547536-39547558 CCATGGCCTCTGGGTTCCTGTGG - Intergenic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
906568940 1:46820084-46820106 TCATGCCCTATGGGATCCTGTGG + Intergenic
908414326 1:63898208-63898230 TCATGACCTGTGAGCTCCTTGGG + Intronic
909704848 1:78569129-78569151 CCAAGCTCTCTGGGTTCCTTGGG + Intergenic
912135208 1:106652660-106652682 CCATGGACTTTGGTATCCTTGGG - Intergenic
912809506 1:112783232-112783254 CCACACCCTGTGGAAGCCTTGGG - Intergenic
916563612 1:165954415-165954437 CCATGGCCTTTGGGGTCCTGGGG + Intergenic
918259656 1:182784189-182784211 CCATGCCCGGTTGGTTCTTTGGG - Intergenic
920741669 1:208586705-208586727 CCCTGCCCTGGGGGAGCCTGAGG + Intergenic
921218695 1:212958159-212958181 CCATGGCCAGTGGGAACGTTGGG + Intronic
922303461 1:224323780-224323802 CCCTGCCCTGTGGGCTCCGTAGG - Intronic
1063088096 10:2837363-2837385 CGCTGGCCTGTGGGATCCTTTGG - Intergenic
1063122729 10:3115864-3115886 AGATGCCCTGTGGCATCCCTGGG + Intronic
1064202891 10:13299707-13299729 CCCTGCCCTCCGGGATCCCTGGG - Intronic
1065857803 10:29844272-29844294 CCAGGCTCTGTGGGATGTTTTGG - Intergenic
1065979566 10:30878707-30878729 GCATGCCCTCTGGGATTCTGGGG + Intronic
1067117662 10:43447589-43447611 CCATGCCCTGTGTGAGCACTGGG + Intronic
1069892794 10:71662430-71662452 CCTTGCCCTGTGGGATACGCAGG - Intronic
1073287293 10:102396579-102396601 CAATCCCCTGTGGCCTCCTTCGG - Intronic
1074104418 10:110377686-110377708 AAATGCCCTGTGGGAGCATTGGG + Intergenic
1076650157 10:131981945-131981967 CCCTGCCCTGTGAGTTCCTCCGG - Intergenic
1076655674 10:132021945-132021967 CCGTCCCCTGTGGGTCCCTTTGG + Intergenic
1077592017 11:3499578-3499600 CCAGGCTGTGTGGGATCTTTTGG + Intergenic
1081155263 11:39682072-39682094 CCCTGACCTGTGGAATCTTTTGG + Intergenic
1084008856 11:66336728-66336750 CCATGCTCTGGGGGCACCTTTGG + Intronic
1084518515 11:69649085-69649107 CCCTGCCCCGTGTTATCCTTTGG + Intronic
1084967701 11:72752922-72752944 CCTTCCGCTGAGGGATCCTTGGG - Intronic
1086591264 11:88516780-88516802 CCATTTCCTGTGGAATTCTTGGG + Intronic
1089604608 11:119634674-119634696 CCAAGCACTGTGCCATCCTTGGG - Intronic
1090027932 11:123183638-123183660 CCATGTCCTGTGGGTTCCTCAGG - Intronic
1093180424 12:15960994-15961016 CCATGCCATGTGGGGGCATTTGG + Intronic
1094500745 12:31018796-31018818 CTTTCCCTTGTGGGATCCTTGGG + Intergenic
1094503661 12:31041964-31041986 CCATGCCCTGGGGGGTTATTGGG + Intergenic
1096225414 12:49863594-49863616 CAAATGCCTGTGGGATCCTTAGG + Intergenic
1098176541 12:67798043-67798065 CAATGCCCTCTGGGGTCCCTTGG + Intergenic
1098334762 12:69391753-69391775 CCAGGCCCTATGCGATACTTGGG - Intergenic
1102471183 12:113160789-113160811 TGATTCCCTGTGGCATCCTTAGG - Intronic
1102855377 12:116288881-116288903 CCATGGCCTGTAGGGTCCTATGG + Intergenic
1103553887 12:121754345-121754367 CCAGGCCCTCGGGGAACCTTGGG - Intronic
1103935571 12:124474804-124474826 CCCCGCCCTGTGCCATCCTTGGG + Intronic
1105707910 13:22980065-22980087 CCTTCCCCTGTGGGAGCCTTGGG + Intergenic
1113138779 13:107123415-107123437 CCATGCCCTGTCTGAAGCTTAGG + Intergenic
1118702640 14:68449345-68449367 CCATGCTCTTTGGGGTCCCTAGG - Intronic
1119226449 14:72947883-72947905 CCCTGGCCTCTGGGACCCTTGGG + Intronic
1119483940 14:74976234-74976256 CCATGCCCTTTGGGAGCCACTGG - Intergenic
1119517536 14:75259824-75259846 CCAGGTCCTTTGGGATTCTTTGG - Intronic
1119757433 14:77128938-77128960 GCATGCCCTCGGGGATGCTTGGG - Intronic
1122017365 14:98807653-98807675 CCATGGCCCTTGGGATCCGTTGG + Intergenic
1122388415 14:101364329-101364351 CCAGGGCCTGTGGGATGCTGGGG - Intergenic
1122409006 14:101516712-101516734 CCATGCCCGTTGTGCTCCTTTGG - Intergenic
1128716254 15:69910347-69910369 CCAAGCCCTCTGAGATTCTTTGG - Intergenic
1129129557 15:73481275-73481297 CCACTCCCTGTGAGATCCATGGG + Intronic
1129867149 15:78917929-78917951 CCAGGCTCTGTAGCATCCTTAGG + Intergenic
1130574718 15:85081652-85081674 CCATGCCCTGTGGGATCCTTGGG + Intronic
1130766219 15:86874203-86874225 CCATGCCCTGTGGAATGGATTGG - Intronic
1131045076 15:89307973-89307995 CCATGCCATGAGGCATCCTCTGG + Intronic
1131110352 15:89760939-89760961 CCCAGCCGTGTGGGATCTTTGGG + Intronic
1134531645 16:14988801-14988823 CCATGCCCTGCAGGATGCCTGGG + Intronic
1135630169 16:24030302-24030324 CCATGCCCTTTGTAAGCCTTTGG - Intronic
1137377001 16:47960368-47960390 TCATGCCATGTGTGAGCCTTGGG + Intergenic
1138010434 16:53373831-53373853 CCATGCCCTGTCGGACCCGCTGG - Intergenic
1139471341 16:67179621-67179643 CGCTGCCCTGTGGCATCATTGGG - Intronic
1140142033 16:72267234-72267256 CCTTCACCTGAGGGATCCTTAGG + Intergenic
1141733832 16:85839577-85839599 CCAGGCTCTGTGGGAAGCTTGGG + Intergenic
1142260248 16:89039509-89039531 CCCTGCCCCGTGGCCTCCTTGGG + Intergenic
1143840648 17:9728750-9728772 CCAGGCCCTCTGGGATCCTGAGG - Exonic
1144335877 17:14268523-14268545 CCAGCCCCTGTGGGCTCCTGGGG - Intergenic
1144731621 17:17529374-17529396 CCATGTGCTGTGGGACGCTTTGG - Intronic
1145907004 17:28521718-28521740 TGATCCCCTGTGGGATCTTTGGG + Intronic
1148442067 17:47716580-47716602 CAATGCCCTGTGGGTTTCTGTGG + Intergenic
1148965439 17:51431217-51431239 CCATGTCCTGGGGGCTGCTTTGG + Intergenic
1151196638 17:72436308-72436330 CCTAGCCCTGTGGGAGGCTTAGG - Intergenic
1151368159 17:73630483-73630505 CCAGGCCCTGGGGGAACCTGGGG - Intronic
1151513710 17:74578807-74578829 CCCTGCCCAGTGGGATCATCTGG - Intergenic
1155788435 18:29932505-29932527 CCATGACCTGTTGGCTCCTTAGG - Intergenic
1157814560 18:50721411-50721433 ACATGGCCTCTGTGATCCTTGGG - Intronic
1159879845 18:73848298-73848320 CCATGGCCTGTGGGATGCATGGG + Intergenic
1159959180 18:74542049-74542071 CCATGCACTCTGGGATCCCAGGG - Intronic
1160947113 19:1648797-1648819 CCATGCCCAGTGGCAGCGTTTGG - Intronic
1161724236 19:5919125-5919147 CCCTGCCCTCTGGTTTCCTTAGG + Intronic
1162111097 19:8400206-8400228 CCATGCGCCGTGGGACCCTCAGG + Intronic
1162280127 19:9689701-9689723 CCATGCTCTGCAGGATCCGTGGG + Intergenic
1163026076 19:14513143-14513165 CCTTGGCGTGTGGGATACTTTGG + Intergenic
1163251302 19:16127834-16127856 CCATGCCCTGTGAGGCCCTGTGG + Intronic
1164767922 19:30785744-30785766 ACATGCCCTGTATGATCCCTGGG + Intergenic
1164807225 19:31126417-31126439 ACAAGCTCCGTGGGATCCTTGGG + Intergenic
1164826950 19:31290765-31290787 CCATGCCCTTCTGGATCCTCTGG - Intronic
1166200915 19:41237594-41237616 CCATGCACTGTGGCATCCTTTGG + Intronic
1166888268 19:45974014-45974036 CCAGGCGCTGTGGGAGCCTCCGG - Intergenic
1167352179 19:48982375-48982397 CCGTGCCTTGTGGGTTCTTTAGG - Exonic
925172466 2:1758877-1758899 CCCTCCCCTGTGGGAGCCTTGGG + Intergenic
925578920 2:5389934-5389956 CCATGCCCTGTGGTTGCCCTTGG + Intergenic
926651682 2:15353177-15353199 CCATTCCCTTAGGGATCCTTTGG - Intronic
927074670 2:19565867-19565889 CCATGACCTGTGGGAACTGTGGG - Intergenic
927461069 2:23298586-23298608 CCATGCCCTGAAGGTTCCATGGG - Intergenic
930012870 2:46950994-46951016 CCTGGCCCTTTGGGCTCCTTGGG + Intronic
930695416 2:54406707-54406729 GCATGGCCTGTGAGATCCTGTGG - Intergenic
931599044 2:63983857-63983879 GCATTACCTGTGGGTTCCTTGGG + Exonic
932389401 2:71372359-71372381 CCATGCACTGAAGGAGCCTTTGG - Intronic
935545442 2:104395580-104395602 CCAGGCCCTGTGGGATTTTGGGG - Intergenic
942409921 2:175698215-175698237 CCATGCCCTGTGTGACTCCTAGG + Intergenic
946453409 2:219800446-219800468 CCATGCCCTGTGCTATGCATGGG + Intergenic
946973759 2:225124377-225124399 CAATGTCCTTTGGGAGCCTTCGG - Intergenic
948752245 2:240139495-240139517 CCATCCCCTCTCAGATCCTTGGG + Intronic
1169198048 20:3693801-3693823 CCTTGGCCTTTGGGAGCCTTGGG + Intronic
1171236737 20:23533351-23533373 GTGTGCCCTGTGGGATCCCTAGG - Intergenic
1172215782 20:33234678-33234700 CCCAGGCCTGAGGGATCCTTTGG - Intergenic
1173400756 20:42723788-42723810 CCATCCCATGTGGGCTCCTTGGG - Intronic
1173835332 20:46121500-46121522 CCATATCCTATGGGATCTTTGGG + Intronic
1176696595 21:9985073-9985095 CCATGCCAAATGGAATCCTTTGG - Intergenic
1177045194 21:16160397-16160419 CCCAGCACTGTGGGAGCCTTAGG + Intergenic
1178630896 21:34260692-34260714 TCATGCCTTGTGAGAACCTTTGG - Intergenic
1178952031 21:36993035-36993057 CCCTGCCCTTTGGGAGGCTTAGG + Intergenic
1180842655 22:18966454-18966476 GCAGGCCCAGTGGGATTCTTGGG + Intergenic
1181058797 22:20272279-20272301 GCAGGCCCAGTGGGATTCTTGGG - Intronic
1181819253 22:25462769-25462791 GCAGGCCCTGTAGGAGCCTTGGG + Intergenic
1183362503 22:37389989-37390011 CCAGGGCCCGTGGGCTCCTTGGG - Intronic
1184734682 22:46391185-46391207 CCATGCCCTAAGGGATCCGTTGG - Exonic
950495012 3:13328527-13328549 CCATGCCCTGTTTCCTCCTTTGG + Intronic
952268868 3:31813315-31813337 CTGTTCCCTGTGGGACCCTTGGG - Intronic
954577399 3:51684162-51684184 CCATGCCCTGTGGAAACCCAGGG - Intronic
957345616 3:78957656-78957678 TCATGCCCTGTGTGATCCTTAGG + Intronic
958702582 3:97613561-97613583 TCATACCATTTGGGATCCTTGGG + Intronic
958732880 3:97977560-97977582 CCAACCCCAGTGGGATCTTTGGG - Intergenic
960262268 3:115581175-115581197 CCTTGCCCTGTGGAAGCCTCAGG - Intergenic
960488379 3:118280386-118280408 CCATGACCCTTGGGATTCTTTGG + Intergenic
961291336 3:125849266-125849288 CCAGGCTGTGTGGGATCTTTTGG - Intergenic
961632776 3:128313396-128313418 CCATGCCATGTGGGAGCCACGGG + Intronic
961895835 3:130167082-130167104 CCAGGCTGTGTGGGATCTTTTGG + Intergenic
962372971 3:134835871-134835893 CCCTGCCCTGTGGGGTCCTTTGG + Intronic
962925717 3:139991640-139991662 CCATGCTCTGTTAGATCCCTCGG + Intronic
967680962 3:192363381-192363403 CCATCCCCTGTTGGAGCCCTGGG + Intronic
968460347 4:721645-721667 CCAGGGCCTGTAGGACCCTTAGG + Intronic
968654837 4:1773962-1773984 CCAGGCCCTGCGCGATCCTCTGG + Intergenic
969005959 4:4020226-4020248 CCAGGCTGTGTGGGATCTTTTGG + Intergenic
969668434 4:8575609-8575631 CCAGGCTCTGGGGGACCCTTGGG - Intronic
969806990 4:9617064-9617086 CCAGGCTGTGTGGGATCTTTTGG - Intergenic
972463619 4:39330205-39330227 CCAGGCACTGTGTTATCCTTAGG + Intronic
977311283 4:95390883-95390905 CCATGCCCAGTGAGATGATTTGG + Intronic
980369204 4:131845245-131845267 CCATGCCAAATGGGATCCTTTGG - Intergenic
983722700 4:170876325-170876347 CCTTGGCTTGTGGGATCCATTGG - Intergenic
985633860 5:1026616-1026638 CCCAGCCCTTTGGGTTCCTTGGG + Intronic
990315065 5:54576080-54576102 TCTACCCCTGTGGGATCCTTGGG - Intergenic
990344583 5:54858914-54858936 CCATGCTCTGCAGGATCCGTGGG - Intergenic
990802790 5:59624238-59624260 CCATCCCCTGTTCCATCCTTTGG + Intronic
996259206 5:121445504-121445526 CCATGCACTGAGGGAGCATTTGG + Intergenic
996802455 5:127419138-127419160 CCATGCCCTCTGGGAACCTATGG + Exonic
1001598149 5:172911469-172911491 CCATGCCCTGCTGGATCTGTGGG + Intronic
1002400614 5:178989820-178989842 CCATTCCCTGTGGTTGCCTTGGG - Intronic
1003112757 6:3263191-3263213 CCAGCCCCTGTGGGCTCCTCAGG - Intronic
1008549108 6:52610631-52610653 CTATGCCATGTGGGATCATTTGG - Intergenic
1014945306 6:127490566-127490588 CCAAGCACTTTGGGAGCCTTAGG + Intronic
1016469989 6:144365048-144365070 CCATGTCCTGTGAGTACCTTAGG - Intronic
1018807443 6:167272226-167272248 CGATGCCCTGTGGGATTCTGAGG - Intronic
1019057354 6:169232921-169232943 TCCTGCCCTGTGGGCTTCTTGGG - Exonic
1019196637 6:170287015-170287037 CCCTGCCCTGCGGGAGCCTCTGG - Intronic
1019210472 6:170400863-170400885 CCATGCTCTGGGGGAGCCCTGGG - Intronic
1019726286 7:2604665-2604687 CCATGCCCTGTCAGCTCCCTGGG + Intronic
1021762208 7:23913150-23913172 ACATGCCCTGTAGCATCATTAGG - Intergenic
1022438543 7:30413161-30413183 CCATGCACGGTTGAATCCTTTGG + Intergenic
1023772579 7:43571806-43571828 CCCTGCACTTTGGGATCCTGAGG + Intergenic
1028406889 7:90485095-90485117 CCAAGCCCTGTGTGGTCCTGTGG - Intronic
1028730231 7:94139093-94139115 CCATGCCCTGTGGAGCCTTTTGG + Intergenic
1029114888 7:98231778-98231800 CCATCTCCTGTGGGACCCGTGGG + Intronic
1029706866 7:102280750-102280772 CCAGGGCCTGTGAGGTCCTTTGG + Intronic
1029745415 7:102513314-102513336 CCAAGCCCTGTGGGGGCCCTGGG - Intronic
1029763354 7:102612293-102612315 CCAAGCCCTGTGGGGGCCCTGGG - Intronic
1030108078 7:106003718-106003740 CAATGTCCTGTTGGCTCCTTAGG + Intronic
1032463205 7:132126819-132126841 CCTTGGCCTGTGGGACACTTGGG + Exonic
1034081620 7:148283354-148283376 CCATGCCTTCTGGAATACTTTGG - Intronic
1036370107 8:8155407-8155429 CCAGGCTGTGTGGGATCTTTTGG - Intergenic
1036880785 8:12510224-12510246 CCAGGCTGTGTGGGATCTTTTGG + Intergenic
1037155617 8:15695211-15695233 CCATGACATGTGGGAACCGTGGG - Intronic
1037701056 8:21274074-21274096 TCATGCCAGGTGGGATGCTTAGG - Intergenic
1039571431 8:38589677-38589699 CCATGGCCTGTGGGAGTCTTGGG + Intergenic
1040342803 8:46449852-46449874 CCAAGCCCTTTGGGAGCCTCAGG - Intergenic
1041291039 8:56308714-56308736 CTATGCCCTTTGGAATCATTAGG - Intronic
1041721470 8:60980102-60980124 CCAAGCCCTGTGAGATCTTCAGG + Intergenic
1044158411 8:88880476-88880498 CCATGCCTTATGGAATTCTTTGG + Intergenic
1045034475 8:98166813-98166835 CCATGCCCTGTAGGCTCCCACGG + Intergenic
1045657068 8:104398381-104398403 CGATGCCCTGTGGGATGCCTGGG + Intronic
1048947956 8:139467818-139467840 CCAACTCCTGTGGGATCGTTAGG - Intergenic
1049447948 8:142640215-142640237 CCCTGCTCTGTGGGACCCTGGGG - Intergenic
1050083734 9:1942171-1942193 GCATTCCCTCTGGCATCCTTAGG + Intergenic
1052815542 9:33100154-33100176 CCATGCCCTGGGGGATCCCTCGG + Intergenic
1053772179 9:41492563-41492585 CTATGCCAAATGGGATCCTTTGG + Intergenic
1054314671 9:63569143-63569165 CCATGCCAAATGGGATCCTTTGG - Intergenic
1055172319 9:73273829-73273851 CTATGCCCTGTGTGATCCCTGGG + Intergenic
1057713329 9:97467002-97467024 CCAAGCCCTGTGTTCTCCTTTGG - Intronic
1057793234 9:98137825-98137847 TTATTCCCTGTGGGATCCTGGGG + Intronic
1058605819 9:106721793-106721815 ACGTGCCCTTTGGGACCCTTTGG + Intergenic
1058888201 9:109338940-109338962 ACATGCCCTGGGGGTTCCTGAGG + Intergenic
1059777552 9:117490812-117490834 TCATTCCCTGTGGGGTGCTTTGG - Intergenic
1061483039 9:130906538-130906560 CCATGCCCTGGCAGGTCCTTGGG - Intronic
1061904576 9:133690130-133690152 CCCTCCCCTCTGGGATCCTGGGG + Intronic
1061972252 9:134051058-134051080 CCAGGCCAGGTGGGATCCTGGGG + Intronic
1186981469 X:14961737-14961759 CCATACCCTGAGAGATGCTTGGG - Intergenic
1190691302 X:52915661-52915683 CCATGCCCTGTGGGGGCTCTGGG + Intergenic
1190694681 X:52940131-52940153 CCATGCCCTGTGGGGGCTCTGGG - Intronic
1192168681 X:68841395-68841417 CCCTTCCTTGTGGGATTCTTGGG + Exonic
1194133196 X:90106780-90106802 CCCTGCCCTGTGTGGCCCTTAGG + Intergenic
1195167909 X:102238681-102238703 TCATGCCCTGTGAGATCCTGAGG - Intergenic
1195190948 X:102448406-102448428 TCATGCCCTGTGAGATCCTGAGG + Intronic
1199451073 X:147979777-147979799 CCTTCCTCTGTGGGATGCTTAGG + Intergenic
1200478984 Y:3676859-3676881 CCCTGCCCTGTGTGGCCCTTAGG + Intergenic
1201774775 Y:17650474-17650496 CCCTGCACTTTGGGATCCTGAGG - Intergenic
1201826781 Y:18255515-18255537 CCCTGCACTTTGGGATCCTGAGG + Intergenic
1201895194 Y:18985403-18985425 CCATGTCCAGTTGGAGCCTTGGG - Intergenic
1202069824 Y:20979351-20979373 CCAAGCACTGTGGGACCCTGAGG - Intergenic