ID: 1130577790

View in Genome Browser
Species Human (GRCh38)
Location 15:85107583-85107605
Sequence CAGTGGAAGGAGAGGGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1971
Summary {0: 2, 1: 2, 2: 20, 3: 199, 4: 1748}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130577779_1130577790 -5 Left 1130577779 15:85107565-85107587 CCTTAGATTTGGCTGACCCAGTG 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1130577790 15:85107583-85107605 CAGTGGAAGGAGAGGGGAGGGGG 0: 2
1: 2
2: 20
3: 199
4: 1748

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130577790 Original CRISPR CAGTGGAAGGAGAGGGGAGG GGG Intronic
900099869 1:957306-957328 AAGTGGAAGTAGAGGGGGCGGGG + Intronic
900204698 1:1427012-1427034 CAGGGCGGGGAGAGGGGAGGGGG - Intronic
900324885 1:2103859-2103881 CAGTGGGAGGAGAGGGGTGAAGG + Intronic
900349582 1:2228248-2228270 CGGTGGGAGGAGCGGGGCGGCGG + Intergenic
900485622 1:2921284-2921306 CTGTGAAGGGAGAGGGGATGCGG - Intergenic
900519306 1:3098036-3098058 CAAAGGAGGGAGAGGGGCGGGGG - Intronic
900538383 1:3190432-3190454 CACAGGAGGGAGAGAGGAGGGGG - Intronic
900809089 1:4787587-4787609 GAGTGGAAGCAGAGGGGCAGGGG + Exonic
900932798 1:5747520-5747542 GGGAGGAAGGAGGGGGGAGGAGG + Intergenic
901167244 1:7229496-7229518 CAGAGGAAGCGGAGAGGAGGTGG + Intronic
901167300 1:7229644-7229666 GAGAAGGAGGAGAGGGGAGGAGG + Intronic
901169542 1:7246622-7246644 CAGAGGAAGGAGGAGGGAAGTGG - Intronic
901266424 1:7914209-7914231 CGGGGGAGGGAGGGGGGAGGGGG - Intergenic
901295376 1:8157099-8157121 CAGAGGAAGGTGTGGGGAGGGGG - Intergenic
901440183 1:9273029-9273051 CAGCAGAAGGGGAGGGGATGCGG + Intergenic
901633319 1:10658376-10658398 AAGTGGATGGGGATGGGAGGAGG + Intronic
901784251 1:11614124-11614146 CAGCGTCAGGAGAGGGCAGGGGG - Intergenic
901930708 1:12595084-12595106 CAGAGGGAGGGGAGGGGAGGCGG + Intronic
901938584 1:12644992-12645014 AGGAGGAAGGAGAGGGAAGGAGG - Intronic
902306480 1:15543456-15543478 GAGTGGAAGAAGAGGGCATGGGG + Intronic
902652077 1:17843660-17843682 AAGTGAAAGGAGAAGGAAGGTGG - Intergenic
902654432 1:17857842-17857864 AGGTGCAAGGAGAGGTGAGGAGG - Intergenic
902654818 1:17859934-17859956 CAGAGGGAGGAGCAGGGAGGTGG + Intergenic
902729985 1:18362928-18362950 CAGAGGCAGAAGTGGGGAGGGGG - Intronic
902756063 1:18550051-18550073 CAGGAGCAAGAGAGGGGAGGAGG - Intergenic
902813975 1:18905495-18905517 GAGTGGGAGGAGAGGGGGTGGGG - Exonic
902875938 1:19340856-19340878 CAGTGGAAAGAGTGGGTAGAGGG + Intronic
903041357 1:20533166-20533188 CTGGGGCAGGAGTGGGGAGGTGG + Intergenic
903446675 1:23426758-23426780 CAGTGGCCGTTGAGGGGAGGAGG + Intergenic
903601673 1:24546541-24546563 AAGGGGATGGAGCGGGGAGGTGG - Intergenic
903625977 1:24730353-24730375 GAGGGGAGGGGGAGGGGAGGGGG + Intergenic
903681689 1:25101833-25101855 CACAGGAAGGAGAGGGGAGGAGG - Intergenic
903867625 1:26410678-26410700 GAGAGGGAGGGGAGGGGAGGGGG + Intergenic
903976401 1:27153267-27153289 AAGTGGAGGGAGAGTAGAGGAGG - Intronic
904010476 1:27387021-27387043 GAGAGGGAGGAGAGGCGAGGTGG - Intergenic
904086971 1:27916194-27916216 GGGTGGGAGGAAAGGGGAGGGGG - Intergenic
904110670 1:28123616-28123638 CAGTGGAGGGGGTGGTGAGGAGG + Intergenic
904197144 1:28794412-28794434 CAGTGGCAGGCTAGGGCAGGGGG - Intergenic
904207651 1:28865184-28865206 CAGCGGAGGGAGAGGAGATGAGG - Intergenic
904372443 1:30058412-30058434 CAGGGGAAGGGGAGGGAGGGTGG - Intergenic
904378692 1:30097119-30097141 CCATGGGAGGGGAGGGGAGGGGG - Intergenic
904624666 1:31795687-31795709 TAGTGGTAGGAGTGGGGAGCAGG + Intronic
904644878 1:31958185-31958207 CAGTGGAGACAGAGGGGAGAGGG - Intergenic
904686853 1:32266752-32266774 AAGGGGAGGGGGAGGGGAGGAGG - Intronic
905447516 1:38036689-38036711 GAGTTAAAGGAGAGGGCAGGGGG + Intergenic
905532050 1:38687584-38687606 CTGTGTAAGGAGAGGGTAAGGGG - Intergenic
905919521 1:41710206-41710228 CCATGCTAGGAGAGGGGAGGTGG - Intronic
905959669 1:42033089-42033111 TGGTGGAGGGAGATGGGAGGAGG + Intronic
906180845 1:43817591-43817613 GAGGAGAAGGAGAAGGGAGGAGG - Intronic
906315617 1:44784810-44784832 CGTGGGAAGGAGAGGAGAGGAGG - Intronic
906509010 1:46400659-46400681 TAGAGGAAGGACAGGGAAGGTGG + Intronic
906613965 1:47222681-47222703 AAGAGGAAGGTGAGGAGAGGGGG - Intronic
906658312 1:47564770-47564792 CAGAGGAAGTAAAGGGGAGAAGG + Intergenic
906691744 1:47797435-47797457 CCTTGGAAGGAGAGGGGAAGTGG - Intronic
906929643 1:50156458-50156480 AAGGGGGAGGAGAGGGAAGGTGG + Intronic
906951838 1:50341109-50341131 GAGTGGGAGGAGGAGGGAGGAGG - Intergenic
907177059 1:52534163-52534185 AATGGGAAGGAGAGGGGACGGGG - Intronic
907407305 1:54261534-54261556 TGGTGGAAGGTGAGAGGAGGAGG + Intronic
907422095 1:54354444-54354466 CAGTGGGTGAAGTGGGGAGGTGG + Intronic
907471942 1:54679804-54679826 AGGTGGGAGGAGAGGGAAGGGGG - Intronic
907515964 1:54993657-54993679 CAGTGGGGGGTGGGGGGAGGGGG - Intergenic
907545877 1:55259458-55259480 TAGTGGAATGATAGGGTAGGAGG + Intergenic
907633297 1:56106573-56106595 CAGTTGATGGTGAGGGCAGGTGG + Intergenic
907798016 1:57737012-57737034 CTGAGGAAGGAAATGGGAGGCGG + Intronic
907850076 1:58247900-58247922 CAAAGGAAGGAGTGGGTAGGGGG - Intronic
907948637 1:59159149-59159171 CAGTAGTAGGAGATAGGAGGGGG + Intergenic
908571868 1:65419897-65419919 GAGAGGCAGGAGAGGGAAGGAGG - Intergenic
909170056 1:72283063-72283085 CTGGGGATGGAGAAGGGAGGGGG + Intergenic
909393080 1:75136998-75137020 CAGGGGGAAGGGAGGGGAGGCGG + Intronic
909510611 1:76448061-76448083 CAGTGCAAGCAGAGAGGAGGGGG + Intronic
909744884 1:79082470-79082492 CAGAGGAAGGGGTGGGGAAGTGG - Intergenic
910161237 1:84274940-84274962 AAAAGGAAGGAGAGGGCAGGGGG - Intergenic
910333011 1:86097550-86097572 GAGGGGGAGGAGAAGGGAGGAGG - Intronic
910357296 1:86374677-86374699 CAGTGGAAGGAAAGGTGAAAAGG - Intronic
910449136 1:87329099-87329121 CAGAAGCAGGAAAGGGGAGGAGG - Exonic
910649294 1:89547798-89547820 TAGTGGGCGGGGAGGGGAGGGGG + Intronic
910777709 1:90892548-90892570 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
910876920 1:91886316-91886338 AAGGGGGAGGAGAGAGGAGGCGG - Intronic
911082659 1:93949212-93949234 CAGAGGAGGGAGAGGGCAAGGGG + Intergenic
911313630 1:96328718-96328740 CAGAGGCTGGAGAGGGGAGGGGG + Intergenic
911520187 1:98920215-98920237 CACTGGAAGTATAGGGAAGGTGG + Intronic
911820337 1:102411303-102411325 CAGGGGAGGGGGAGGGGAGGAGG + Intergenic
911870827 1:103096051-103096073 CATTGGAAGGTTAGGGGAGAAGG + Intronic
912497272 1:110099733-110099755 AAGAGGATGAAGAGGGGAGGGGG + Intergenic
912662156 1:111541753-111541775 CAGTGGAGGGACAGGGGACGAGG + Intronic
912703393 1:111894997-111895019 CAGGGGGAGGGAAGGGGAGGAGG + Intronic
912717052 1:111990096-111990118 CAGTGGAGGAAGAGAGGAGGAGG + Intergenic
912764463 1:112396219-112396241 CTGTGGATGGGGAGTGGAGGCGG + Exonic
912799239 1:112710972-112710994 TAGAGGTGGGAGAGGGGAGGAGG - Intronic
913533193 1:119747713-119747735 CAGGGGAGGAGGAGGGGAGGAGG - Intergenic
914196783 1:145451877-145451899 AAGTGGGAGGAGGAGGGAGGGGG + Intergenic
914464450 1:147913727-147913749 CAGGGAAAGGAGAGAAGAGGAGG - Intergenic
914788489 1:150854881-150854903 AAGGGGAAAGAGAGGGAAGGAGG + Intronic
914916095 1:151820126-151820148 CAGGGGAAGGAGGGGGGAGCAGG - Intronic
914988793 1:152480817-152480839 CAGAGCAAGCAGAGTGGAGGTGG - Intergenic
915101816 1:153506523-153506545 CAGAGGAAGCAGATGAGAGGTGG - Intergenic
915275197 1:154783692-154783714 GACTGGAAGGAGAGGGGAGCTGG + Intronic
915311564 1:155008119-155008141 AAGAGGAAGGAGCTGGGAGGGGG - Intronic
915343281 1:155187663-155187685 CACTGGAAGGAGAGGGGCCCCGG + Intronic
915583221 1:156828687-156828709 CAATGGAAGGAGAGTGGTGGGGG + Intronic
916045714 1:160998669-160998691 CAGTGGTAGGAAAGGGAGGGAGG + Exonic
916108732 1:161448175-161448197 CGGAGGAAGGAGAGAGAAGGAGG + Intergenic
916110320 1:161455556-161455578 CGGAGGAAGGAGAGAGAAGGAGG + Intergenic
916111905 1:161462966-161462988 CGGAGGAAGGAGAGAGAAGGAGG + Intergenic
916113492 1:161470347-161470369 CGGAGGAAGGAGAGAGAAGGAGG + Intergenic
916197825 1:162241205-162241227 CAAGGGAAGCAGAGGAGAGGTGG + Intronic
916412359 1:164559073-164559095 GAGAAGGAGGAGAGGGGAGGGGG - Intronic
916493975 1:165328062-165328084 CAGTGGAAGGAGAGATAAGGAGG + Intronic
916559950 1:165925997-165926019 TGGTGGCATGAGAGGGGAGGAGG + Intergenic
916630069 1:166602804-166602826 GGGTGGGAGGAGTGGGGAGGGGG + Intergenic
916763014 1:167833860-167833882 CTGTGGCAAGAGATGGGAGGAGG + Intronic
917125330 1:171682557-171682579 GAGGGGAGGGGGAGGGGAGGGGG - Intergenic
917188867 1:172392087-172392109 GAGAGGAAGGAGAGAGGTGGTGG + Intronic
917635195 1:176929140-176929162 CAGTGGCTGGAGAGGTGAGAGGG + Intronic
917854649 1:179090616-179090638 TGGTGGCAGGAGAGAGGAGGTGG + Intronic
917926249 1:179791389-179791411 CCTTGGAAGGAGAGAGCAGGGGG - Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918284915 1:183042800-183042822 CAGTGCCAGGAGAGGGCTGGGGG - Intronic
918421696 1:184370707-184370729 TAGTGGAAAGTGAGGTGAGGAGG - Intergenic
918952748 1:191160690-191160712 GAAGGGAAGGAGAGGGGAGAGGG + Intergenic
919176720 1:194028433-194028455 GAGGGGAAGGGGAGGGGAGGGGG - Intergenic
919506596 1:198406458-198406480 CAGAGGGTGGAGGGGGGAGGGGG + Intergenic
919728579 1:200899158-200899180 AAGAGGAAGAAGAAGGGAGGAGG + Intronic
919838766 1:201594333-201594355 CAGGAGAAAGGGAGGGGAGGAGG + Intergenic
919840414 1:201605216-201605238 GAGAGGATGGAGAGGGAAGGTGG - Intergenic
919847614 1:201651400-201651422 GAGGGGCAGGAGTGGGGAGGAGG + Intronic
920215396 1:204358928-204358950 CAGTGGAAGGGGAGGGAAGCGGG - Intronic
920434382 1:205938700-205938722 GAGAGGAAGGAGAGGGTTGGAGG - Intronic
920612870 1:207458718-207458740 CACTGGAAGGAGAAGGGACAGGG - Intronic
920647063 1:207811612-207811634 AAGTGGAAGCAGAGGGCTGGAGG - Intergenic
920814085 1:209314745-209314767 AAGTGGAAGGAAAGGGGAGAAGG + Intergenic
920832606 1:209479043-209479065 AAGTGGAGGGAGAGGAGAGAGGG + Intergenic
921396849 1:214677782-214677804 AAGGGGGAGGAGAAGGGAGGAGG - Intergenic
922023414 1:221727828-221727850 CAGTGAGAGGGGAAGGGAGGGGG - Intronic
922095603 1:222440503-222440525 AAGAGGAGGGAGAGGGAAGGAGG + Intergenic
922251842 1:223856495-223856517 GAGTGGGAGCAGAAGGGAGGCGG + Intergenic
922455535 1:225770893-225770915 GAGGGGAAGGGGATGGGAGGAGG + Intergenic
922465072 1:225841013-225841035 CTTTTGAAGGAGAGGGGATGTGG - Intronic
922852170 1:228742304-228742326 CAGTGGCAGGCGAGGGGATTTGG - Intronic
923017946 1:230141446-230141468 CAGGGGGAGGGGAGGGGAGAAGG - Intronic
923051881 1:230395418-230395440 GAGTGGGAGGAGAGGAGGGGAGG - Intronic
923051985 1:230395760-230395782 GAGTGTGAGGAGGGGGGAGGAGG - Intronic
923505345 1:234600421-234600443 CACGGGAAGGAAAGGGGAGGAGG - Intergenic
923534463 1:234838235-234838257 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
923602076 1:235412166-235412188 GAGGGGGAGGGGAGGGGAGGGGG - Intronic
923602086 1:235412182-235412204 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
923602093 1:235412193-235412215 GAGGGGGAGGGGAGGGGAGGGGG - Intronic
923602103 1:235412209-235412231 GAGGGGGAGGGGAGGGGAGGGGG - Intronic
924027069 1:239844878-239844900 CAGAAGAAGTAGAGGGGTGGAGG + Intronic
924049300 1:240064158-240064180 AAGTGGGAGGGGAGGGGAGTAGG + Intronic
924067159 1:240235823-240235845 CAGAGGAAGAAGAGGGGAGATGG - Intronic
924329195 1:242925349-242925371 GAGAGAAAGGAGAGAGGAGGCGG - Intergenic
924436552 1:244048600-244048622 CGGGGGAGGGGGAGGGGAGGGGG - Intergenic
924562392 1:245167852-245167874 GAGAGGAATAAGAGGGGAGGAGG + Intronic
924581902 1:245330565-245330587 GAGTGGAGGGAGAGTGGGGGAGG + Intronic
924581911 1:245330588-245330610 GAGTGGAGGGAGAGTGGGGGAGG + Intronic
924632993 1:245760011-245760033 TAGTGACAGGAGAGGGCAGGAGG + Intronic
924672326 1:246141830-246141852 CAGTGGAAGCAGAGTCGAGCTGG + Intronic
1063050033 10:2437068-2437090 CACTTGATGGAGACGGGAGGTGG - Intergenic
1063187395 10:3663729-3663751 CCGTGGAAGGTGAGGGGCTGGGG - Intergenic
1063410136 10:5831168-5831190 CCGTGGAAGGGAAGGTGAGGAGG - Intronic
1063440792 10:6071417-6071439 AAGAGGAAGGAGGAGGGAGGAGG - Intergenic
1063454534 10:6173902-6173924 CAGTGGACGCAAACGGGAGGCGG + Intronic
1063482144 10:6385326-6385348 GAGTGGGAGGAGGAGGGAGGTGG - Intergenic
1063612804 10:7577016-7577038 CAGTGGAAGCACAGGGAGGGAGG + Intronic
1063706299 10:8434154-8434176 GAGTGGAAGGACAGAAGAGGAGG - Intergenic
1063753330 10:8977018-8977040 ATGTGGAAGGAGGGGGGGGGGGG + Intergenic
1063974956 10:11407645-11407667 GGCTGGAAGGAGAGGGGATGAGG - Intergenic
1064114791 10:12568383-12568405 GAGGGGAAGGGGAGGGGAGAAGG - Intronic
1065167089 10:22990989-22991011 CAGAGGAAGCAGAGAGGAGGAGG - Intronic
1065234369 10:23633519-23633541 CAGAGGATGTAGATGGGAGGGGG - Intergenic
1065620490 10:27576145-27576167 CAGAGGTAGGAGAGGTGATGTGG - Intergenic
1066273537 10:33846457-33846479 CACAGGATGGGGAGGGGAGGAGG - Intergenic
1066325201 10:34352349-34352371 AAGTGGAGGGAGAGGGGAGAGGG - Intronic
1066456532 10:35577151-35577173 CCCTGTAAGGAGAGGGGAGTCGG + Intergenic
1066468290 10:35672245-35672267 CTGTGGAAGTAGCTGGGAGGAGG + Intergenic
1067081209 10:43213436-43213458 CAGGGTGAGAAGAGGGGAGGGGG + Intronic
1067546015 10:47193172-47193194 CAGGGGAAACAGAGGGCAGGAGG + Intergenic
1067561748 10:47309448-47309470 CAGAGGCAGTAGAGGGCAGGGGG + Intronic
1067682050 10:48447613-48447635 CAGGGGCAGCAGTGGGGAGGTGG - Intronic
1068585426 10:58792841-58792863 CAGGGGAGGGGGAGGGAAGGGGG - Intronic
1068631469 10:59303057-59303079 GAGTGGTAGGAGAGGGGACCAGG - Intronic
1068659851 10:59612640-59612662 CAGAGGTAAGAGAGGGAAGGTGG - Intergenic
1068956045 10:62819030-62819052 CAGTAGAAGGCGGGTGGAGGAGG + Intronic
1069718518 10:70535587-70535609 AAGAGGAAGGAGAAGGAAGGAGG - Intronic
1069721884 10:70554968-70554990 CAAAGAAAGGGGAGGGGAGGAGG - Intronic
1069827941 10:71265748-71265770 CAGTGGAAGCACAGGGAAGGTGG - Intronic
1070182248 10:74025621-74025643 AAAGGGAAGGGGAGGGGAGGGGG + Intronic
1070279012 10:75035370-75035392 GAGTGGAAGGAGAGGGGCAGAGG - Intergenic
1070383752 10:75904972-75904994 CAGTGGAAGGAGGGGAGAGAGGG + Intronic
1070646825 10:78207565-78207587 TACTGTAAGGAGTGGGGAGGAGG - Intergenic
1070680553 10:78446086-78446108 GAGGAGAAGGAGAAGGGAGGAGG + Intergenic
1070842269 10:79495403-79495425 CAGTGGGGGCAGAGGGGAAGCGG + Intergenic
1071263539 10:83943171-83943193 CAGTGGAGGGTGCGGCGAGGAGG - Intergenic
1071525923 10:86358291-86358313 GGGTGGAAGGAAAGTGGAGGTGG + Intronic
1071569688 10:86690228-86690250 CACTGGGAGGGGAGGGAAGGAGG - Intronic
1072148766 10:92667802-92667824 AAGAGGAAGAAGAGGGGGGGAGG + Intergenic
1072645624 10:97251511-97251533 GAGGGGAAGGGGAGGGGAAGGGG + Intronic
1072645630 10:97251522-97251544 GAGGGGAAGGGGAGGGGAAGGGG + Intronic
1072882413 10:99240787-99240809 TAGTAGAAGGAAAGGGCAGGCGG - Intergenic
1072983803 10:100122074-100122096 GAAGGGAAGGGGAGGGGAGGTGG + Intergenic
1073031400 10:100529225-100529247 CTGTGGAGGGAGGTGGGAGGGGG - Intronic
1073150114 10:101305704-101305726 CTGAGGAAGGGGACGGGAGGGGG - Intergenic
1073447577 10:103590572-103590594 CAGAGGGAGGGGAGGAGAGGAGG + Exonic
1073529170 10:104215853-104215875 CATTGTAAGGGGAGAGGAGGCGG - Intronic
1073685553 10:105748998-105749020 GCGTGGAAGGAGAGTGGAAGTGG - Intergenic
1074185784 10:111098523-111098545 CAGGAGAAGGAGAGAGGATGAGG - Intergenic
1074290410 10:112133848-112133870 CAGTGGTGGGAGAGTGGAGAGGG - Intergenic
1074293549 10:112160257-112160279 GAGAGGAAGGAGAGAAGAGGGGG - Intronic
1074326356 10:112455270-112455292 GAGGGGGAGGGGAGGGGAGGAGG - Intronic
1074603861 10:114941064-114941086 GAGTGGACAGAGAAGGGAGGAGG - Intronic
1074661373 10:115661917-115661939 GGGTGGGAGGAGGGGGGAGGGGG - Intronic
1074778848 10:116785878-116785900 CAGTCTAAGGTGAGGGGAGGGGG - Intergenic
1074964086 10:118473445-118473467 GAGAGGGAGCAGAGGGGAGGAGG - Intergenic
1075108726 10:119560495-119560517 CCGTGGAAAGAGAGGGGGAGGGG + Intergenic
1075108738 10:119560519-119560541 AGGTGGAGGGAGAGGGGAGGGGG + Intergenic
1075575204 10:123572768-123572790 GAGGAGGAGGAGAGGGGAGGAGG + Intergenic
1075575210 10:123572784-123572806 GAGGAGGAGGAGAGGGGAGGAGG + Intergenic
1075589969 10:123684195-123684217 CAGTGGAAGGTCTGGGCAGGTGG + Intronic
1075596846 10:123738081-123738103 CAGGAGAAAGAGAGGGCAGGGGG - Intronic
1075663581 10:124215170-124215192 CAGAGGAAGGCCAGGGAAGGCGG - Intergenic
1075916706 10:126174181-126174203 CAGTGGGGGGAAGGGGGAGGAGG - Intronic
1076058738 10:127396457-127396479 CAGTGGCTGGACAGGGGAGTTGG - Intronic
1076070449 10:127484356-127484378 CAGAGGAGGGAGAGAGGATGAGG - Intergenic
1076312494 10:129518475-129518497 CAGGGGGAAGGGAGGGGAGGAGG - Intronic
1076312507 10:129518500-129518522 CAGGGGGAAGGGAGGGGAGGAGG - Intronic
1076318862 10:129564169-129564191 GAGTGGAAGAAGAAGGGAGGGGG - Intronic
1076405944 10:130212666-130212688 CAGTGGGAGGGGAGGGGAAGGGG - Intergenic
1076462903 10:130658556-130658578 CAGTGTGAGGAGAGAGGAAGAGG + Intergenic
1076666812 10:132097911-132097933 AAGGGGAAGGAAAGGGGAAGGGG - Intergenic
1076861705 10:133141021-133141043 ATGTGGAAGGAGAGGGACGGTGG - Intergenic
1077204078 11:1333189-1333211 GAGTGGAGGGAGAGGGCGGGAGG + Intergenic
1077218099 11:1403469-1403491 GAGTGGAAGGAGCAGAGAGGGGG - Intronic
1077307178 11:1873635-1873657 GAATGGAAGGAGGAGGGAGGAGG + Intronic
1077411429 11:2405662-2405684 CCCTGGCAGGAGAGGGGAGATGG - Intronic
1077531309 11:3096938-3096960 AAGAGGGAGGAGATGGGAGGAGG + Intronic
1077531341 11:3097045-3097067 CAGGAGAAGGAGAGGAAAGGGGG + Intronic
1077544189 11:3161970-3161992 GAGAGGGAGGGGAGGGGAGGGGG + Intronic
1077724693 11:4662274-4662296 GAGAGGAAGGAGAGGGAGGGAGG - Intergenic
1077923073 11:6655824-6655846 CGGGGGGAGGGGAGGGGAGGGGG - Exonic
1077960965 11:7076653-7076675 CTTTGGTAGGAAAGGGGAGGGGG - Intergenic
1078159767 11:8830637-8830659 CAGAGGAAGGAGAGAAGAGGTGG + Intronic
1078170898 11:8928543-8928565 CTGTGGGAGGAGGGTGGAGGTGG - Intronic
1078390558 11:10932136-10932158 GAGTGGAGGGAAAGGAGAGGAGG + Intergenic
1078390595 11:10932235-10932257 TGGAGGAAGGAGAGAGGAGGAGG + Intergenic
1078391427 11:10938601-10938623 AAGGGGAAGGAGATGGGAAGGGG - Intergenic
1078857735 11:15220267-15220289 CAGGGGAAGAACAGGAGAGGTGG - Intronic
1078877793 11:15415461-15415483 TAGTGGGAGGAGAAGGGAGGAGG + Intergenic
1079029659 11:16977112-16977134 TGGTGGAGGGAGAGAGGAGGAGG - Intronic
1079121494 11:17688296-17688318 CAGAGGAGGGAAAGGGCAGGGGG + Intergenic
1079129413 11:17738611-17738633 CAGTGGGAGGAGAGGGCCAGGGG - Intronic
1079135912 11:17775919-17775941 CAGGGGAAGTAGAGGGGCTGGGG - Intronic
1079366470 11:19814372-19814394 CAGGGGAGGGAGAGGGCAGTGGG - Intronic
1079475048 11:20821254-20821276 TAGAGGAAGGAGAAGGGTGGAGG - Intronic
1079995779 11:27293618-27293640 GAGGGGGAGGGGAGGGGAGGCGG + Intergenic
1080092064 11:28360285-28360307 GAGTGGGATGAGAGGTGAGGTGG - Intergenic
1080193402 11:29578794-29578816 CAGTGGAATGAGAGAGGAAGTGG - Intergenic
1080210798 11:29782598-29782620 GACTGGGAGGAGAGCGGAGGAGG - Intergenic
1080384274 11:31801476-31801498 CAGTGGAGAGAGAGGGTGGGAGG + Intronic
1080410686 11:32022260-32022282 CAGTGGAAGGAGTTGGGAGCAGG - Intronic
1080946551 11:36980750-36980772 CAGGAGAAAGAGAAGGGAGGAGG + Intergenic
1081574462 11:44310492-44310514 CAGTGGAAGGAGAGAGGAGGAGG - Intergenic
1081726413 11:45332629-45332651 CAGTGGCGGGAGAGTGGGGGCGG - Intergenic
1081771354 11:45652144-45652166 GAAGGGAAGGAGTGGGGAGGGGG - Intronic
1081931654 11:46875685-46875707 CAGAGGAAGGAGAGGGTGGGGGG + Intronic
1082050726 11:47768338-47768360 CAGAGGCAGGAGACGGGAGAGGG - Intergenic
1082097559 11:48143791-48143813 GAGGAGGAGGAGAGGGGAGGGGG - Intronic
1082097573 11:48143824-48143846 GAGGAGGAGGAGAGGGGAGGGGG - Intronic
1083043904 11:59714837-59714859 CAGAGGGAGGAGAAGGGAGATGG - Intronic
1083086776 11:60156274-60156296 CAGTGGAAGCAAGGGGGAAGAGG - Intergenic
1083254934 11:61490109-61490131 CACTGGAAGGAGAGGAGGGGAGG - Intronic
1083566864 11:63726414-63726436 CAGTGGAATGTAAGGGGAGGAGG + Intronic
1083612766 11:64011990-64012012 CAGTGGAGGTGGTGGGGAGGGGG - Intronic
1083620522 11:64047185-64047207 CTGGGGCAGGGGAGGGGAGGGGG - Intronic
1083630716 11:64093798-64093820 GGGTGGAAGGAGGGAGGAGGTGG + Intronic
1083687527 11:64385478-64385500 CACTGGACACAGAGGGGAGGTGG + Intergenic
1083701151 11:64478424-64478446 CAGGGGAAGGGAAGTGGAGGAGG + Intergenic
1083713915 11:64565064-64565086 TAGGGGAAGGGGAGGGGATGGGG - Intronic
1083722986 11:64612578-64612600 CAGAGGAAGGAGAGTTGGGGAGG - Intronic
1083743341 11:64722538-64722560 TCGTGGGAGGAGAGGAGAGGGGG - Intronic
1083887727 11:65581031-65581053 GAATGGTAGGAGAGGGGAGAAGG - Intronic
1083894083 11:65611533-65611555 CAGGGGAACTAGAGGGGAGTAGG + Intronic
1083913040 11:65721010-65721032 AGGGGGAAGGAGGGGGGAGGGGG - Intergenic
1083966418 11:66046589-66046611 CAGGAGTAAGAGAGGGGAGGAGG + Intronic
1084104925 11:66975073-66975095 GAGGGGAGGGGGAGGGGAGGGGG + Intergenic
1084511259 11:69605707-69605729 GGGTGGAAGGAGAGGGGAGCAGG - Intergenic
1084587067 11:70068519-70068541 CAGTGGAAGGGGCTGGGAGTGGG + Intergenic
1084757533 11:71249266-71249288 AAAGGGAAGGAGAGGGGAGAAGG - Intronic
1084920321 11:72464427-72464449 GAGGGGGAGGAGGGGGGAGGAGG - Intergenic
1084972185 11:72777930-72777952 CTGAGGCAGGAGAGGGGAGGGGG + Intronic
1085020227 11:73202073-73202095 CAGGGGAAGGGGTGGGGATGAGG - Intergenic
1085024242 11:73227504-73227526 TAGAGGTAGGAGTGGGGAGGAGG + Intronic
1085085577 11:73664422-73664444 AAATGGAAGGGGAAGGGAGGGGG - Intergenic
1085265937 11:75238105-75238127 AAGTGGGAAGAGAGGAGAGGAGG + Intergenic
1085592587 11:77778098-77778120 CTTGGGAAGGGGAGGGGAGGAGG + Intronic
1085592641 11:77778204-77778226 GAGAGGATGGGGAGGGGAGGGGG + Intronic
1085745605 11:79111815-79111837 CAGAGAAAGGAGGTGGGAGGGGG + Intronic
1085752241 11:79171578-79171600 CTGGGGAAGGAGAGAGGAAGAGG + Intronic
1085755539 11:79198469-79198491 TGGTGGAAGGAGGGGGAAGGAGG - Intronic
1085776666 11:79372680-79372702 CTGTGAAATGGGAGGGGAGGGGG + Intronic
1085923611 11:80988681-80988703 CAGGGGAAGGAGTGGGAGGGAGG + Intergenic
1086743671 11:90399703-90399725 CACTGGAAGTGGAGGGGTGGGGG + Intergenic
1087219869 11:95535273-95535295 CAGTGGAAGGAAATGGGTGAAGG + Intergenic
1087466191 11:98509711-98509733 CAGGGGAAAGAGTGGGAAGGAGG - Intergenic
1087662964 11:101009208-101009230 CAGTGGAATGACAGTGCAGGGGG - Intergenic
1088339330 11:108745128-108745150 GAGTGGAAGGAGAAGGGAGAAGG - Intronic
1088376944 11:109151719-109151741 GAGGGGAGGGGGAGGGGAGGAGG - Intergenic
1088454808 11:110022469-110022491 CTGTGGAAGGAAAGGGGAGATGG - Intergenic
1088876617 11:113941680-113941702 CAGTGGCAGGAGATGGGAGGAGG + Intronic
1089196433 11:116696351-116696373 CAGTGGAGAGGGCGGGGAGGTGG - Intergenic
1089335998 11:117724402-117724424 CTGTGGAAGGTGAGGGTGGGAGG + Intronic
1089649663 11:119904495-119904517 CTTTGGGAGGAGAGGAGAGGAGG + Intergenic
1089653902 11:119933266-119933288 CAGTGGCAGAAGCTGGGAGGAGG - Intergenic
1089676176 11:120091407-120091429 GGGTAGAAGGAGAGGGAAGGTGG - Intergenic
1089763750 11:120748266-120748288 GGGTGGAAGGAGATGGGAGGTGG - Intronic
1089778844 11:120858914-120858936 CTGTGGAAGGACAAGGAAGGGGG - Intronic
1089779822 11:120865914-120865936 TGGTGGAAGGCAAGGGGAGGGGG + Intronic
1089895859 11:121929302-121929324 GGGGGGAAGGGGAGGGGAGGAGG + Intergenic
1090062627 11:123477268-123477290 GAGGGGAGGGAGAGGGGAGGGGG - Intergenic
1090205055 11:124879439-124879461 CAGTGTTAGGAGACGGGAAGAGG - Intronic
1090229072 11:125088830-125088852 CAGTGGAAGGTGATGGGGGCCGG + Exonic
1090269713 11:125377599-125377621 GGCTGGAAGGAGAGGGCAGGCGG - Intronic
1090333922 11:125950484-125950506 AAGGGGAAGGGGAAGGGAGGGGG + Intergenic
1090645685 11:128765050-128765072 CGGGGGAGGGAGAGAGGAGGAGG + Intronic
1090744206 11:129693680-129693702 AAGGGGAAGGAAAGGGGAAGGGG + Intergenic
1090764486 11:129864913-129864935 CAGTGGAATCAGAGAGGAGCCGG + Intronic
1090974599 11:131670853-131670875 CAGAGGGAGCAGAGGGGAAGGGG - Intronic
1091070523 11:132558431-132558453 TAGGGGAAGAGGAGGGGAGGAGG - Intronic
1091211331 11:133864020-133864042 CAGTGGCGGGGGAGGGGCGGGGG + Intergenic
1091234125 11:134008381-134008403 CAGAGCAGGGAGAGGAGAGGTGG - Intergenic
1091357314 11:134947267-134947289 CAGTGGACAGAGTGGGAAGGTGG - Intergenic
1091544833 12:1494688-1494710 CAGAGAAAGAAGAGAGGAGGTGG - Exonic
1091596281 12:1881120-1881142 CAGGGACAGGAGAGGGAAGGAGG + Intronic
1091600057 12:1912570-1912592 GAGAAGGAGGAGAGGGGAGGGGG + Intronic
1091616838 12:2055866-2055888 TTGGGGTAGGAGAGGGGAGGAGG + Intronic
1091626383 12:2124078-2124100 CAGTGGAAGGAGAGACCAGAGGG - Intronic
1091648844 12:2294491-2294513 CAGTGGAGAGTGAGGGGCGGGGG + Intronic
1091680393 12:2522732-2522754 CAGAGGAAGGACAGGGGCAGAGG + Intronic
1091843550 12:3637625-3637647 AAGTGGAGGGAAAGGGGAAGGGG - Intronic
1091883744 12:4001150-4001172 GAGTGAAAGGAGAGGGTGGGTGG - Intergenic
1091945722 12:4539549-4539571 CAGTGGGAGGTGAGGTTAGGGGG + Intronic
1092061148 12:5551579-5551601 GGGTGGAAGGAGAGGGGAAACGG - Intronic
1092083708 12:5738581-5738603 AAGTGAAAGAAGAGGGGAGGAGG + Intronic
1092195660 12:6548342-6548364 CAGAGCAAGGAGAGGAGCGGGGG + Intronic
1092542143 12:9426657-9426679 CATGGGAAGAAGAGGGGAGAAGG + Intergenic
1092817263 12:12322979-12323001 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
1092817268 12:12322990-12323012 GAGGGGAGGGGGAGGGGAGGAGG + Intergenic
1092817323 12:12323092-12323114 GAGGGGAGGGGGAGGGGAGGGGG + Intergenic
1092817333 12:12323108-12323130 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
1092817340 12:12323119-12323141 GAGGGGAGGGGGAGGGGAGGGGG + Intergenic
1092892083 12:12978569-12978591 CAGTGGAGGGACAGGGGAAATGG + Intronic
1092998247 12:13971481-13971503 CAGAGGAGGAAGAGGGTAGGAGG - Intronic
1093011372 12:14110961-14110983 GAGTGGAAGGTAAGGGCAGGAGG + Intergenic
1093016548 12:14161155-14161177 CAGGAGAGGGAGGGGGGAGGAGG + Intergenic
1093322715 12:17734017-17734039 CAGTGGTAGCAGAGAAGAGGAGG - Intergenic
1093647257 12:21601248-21601270 CAGTTGAGGGAGAGGAGAGGAGG - Intronic
1093662632 12:21774806-21774828 CAGTGGAAGGAGGAGGGACTGGG + Exonic
1094199592 12:27781921-27781943 GAGTGGGATGAGAGGGGAGAAGG + Intronic
1094510869 12:31095776-31095798 CATGGGAAGAAGAGGGGAGAAGG - Intronic
1095477781 12:42603496-42603518 GGGTGGAGGGAGCGGGGAGGAGG - Intergenic
1095825307 12:46524800-46524822 CTGGGGATGGAGATGGGAGGAGG + Intergenic
1095987061 12:48005561-48005583 CCGGGGAAGGTGAGGTGAGGCGG - Intergenic
1096080765 12:48830855-48830877 CAGTAGGAGGACAGGGGAGATGG - Intronic
1096089695 12:48890787-48890809 CAGTGAAAGCAGGGGCGAGGTGG + Intergenic
1096146192 12:49280707-49280729 AGGAGGAAGAAGAGGGGAGGAGG - Intergenic
1096146849 12:49284367-49284389 CTGAGGAAGGAAAGGGCAGGGGG - Intergenic
1096319487 12:50598879-50598901 GAGAGGGGGGAGAGGGGAGGGGG - Intronic
1096354408 12:50928227-50928249 CAGTGGTAGGAGATGGGTAGAGG - Intronic
1096356885 12:50948871-50948893 GAGGGGAGGGGGAGGGGAGGGGG + Intergenic
1096512259 12:52137558-52137580 GAGTGGGAGGAGAGGGCATGTGG + Intergenic
1096528403 12:52228109-52228131 GAGGGGAGGGGGAGGGGAGGGGG - Intergenic
1096668194 12:53180923-53180945 AAGGGGGAGGGGAGGGGAGGAGG + Intronic
1096673074 12:53211557-53211579 CATTGGAAGGGGTGGGGAGAGGG + Exonic
1096675703 12:53224714-53224736 AAGTGGCAGGAGGAGGGAGGAGG - Intronic
1096779711 12:53984889-53984911 CAGGGGAGGTAGAGGGGTGGAGG - Intergenic
1096788076 12:54029220-54029242 CAGTCTGAGGAGAAGGGAGGGGG + Intronic
1096801960 12:54116369-54116391 CCTTGGCAGGAGATGGGAGGAGG + Intergenic
1096813398 12:54185916-54185938 GGGAGGAAGGAGAAGGGAGGGGG + Intronic
1097110248 12:56652459-56652481 GAGGGGAGGGGGAGGGGAGGGGG + Intergenic
1097167872 12:57095158-57095180 ACGGGGAAGGAGAGGGGAGAAGG - Exonic
1098060144 12:66553333-66553355 CAAGGGAGGGAGAGGGAAGGAGG - Intronic
1098365956 12:69703312-69703334 CAGGGGTAGGCGAGAGGAGGAGG + Intergenic
1098857787 12:75672401-75672423 CTGTGCAAGGAGAGAGGAGAAGG + Intergenic
1099119333 12:78668425-78668447 CAGGGCAAGGGGATGGGAGGTGG - Intergenic
1099385314 12:82006256-82006278 AGGAGGAAGGGGAGGGGAGGGGG + Intergenic
1099779049 12:87171241-87171263 GAGAAGGAGGAGAGGGGAGGAGG + Intergenic
1100144470 12:91660518-91660540 CAGAGGTAGATGAGGGGAGGGGG + Intergenic
1100148100 12:91701842-91701864 TAGTGGAAAGCAAGGGGAGGAGG + Intergenic
1100348278 12:93753791-93753813 CAGTGAAAGCAGCTGGGAGGGGG - Intronic
1100619409 12:96256805-96256827 CAGAGGAAGGCAAGAGGAGGAGG + Intronic
1100770960 12:97922453-97922475 TAGTGGAAGCAGAGGTCAGGAGG + Intergenic
1100891062 12:99126497-99126519 CAGGGTAAGGTGGGGGGAGGGGG - Intronic
1101409909 12:104458814-104458836 CAGTGAAAGGAGAAGGCGGGAGG - Intronic
1101568029 12:105928027-105928049 CAGTGGGAAGAGAGTGGAAGAGG + Intergenic
1101580554 12:106037927-106037949 AAAAGGGAGGAGAGGGGAGGAGG - Intergenic
1101673315 12:106896647-106896669 GGGAGGAAGGGGAGGGGAGGGGG + Intergenic
1101673329 12:106896673-106896695 GGGAGGAAGGGGAGGGGAGGGGG + Intergenic
1101774302 12:107779573-107779595 CAGAGGAGGGGGAGGGGATGAGG + Intergenic
1101843168 12:108342162-108342184 CAAGGGGAGGAGAGGGGAGAGGG + Intergenic
1101901299 12:108792846-108792868 TAGAGGAAGGTGAGGGGAGGAGG + Intronic
1102167860 12:110820762-110820784 CAGGGGGAGGGAAGGGGAGGGGG - Intergenic
1102394136 12:112573873-112573895 TGGTGGAGGGAGAGGGGTGGTGG + Intronic
1102538570 12:113601085-113601107 GAGTATAAGGAGAGAGGAGGGGG + Intergenic
1102789871 12:115635980-115636002 AAGAGGAGGGGGAGGGGAGGAGG + Intergenic
1102984244 12:117265511-117265533 CTGTGGGAGGAGAGGGGACAGGG + Intronic
1102991507 12:117319567-117319589 CAGTGGCAGGAGCTGGGAAGGGG - Intronic
1103276423 12:119715526-119715548 TAGTGGAAGGAGAATGGCGGGGG + Intronic
1103280806 12:119756563-119756585 TGGTGGAAGGTGGGGGGAGGGGG + Intronic
1103330131 12:120148467-120148489 CACTGGGAGGAGGGGAGAGGGGG + Intronic
1103413193 12:120726983-120727005 GAGTGGAAGGAGGAGGCAGGAGG - Intronic
1103414748 12:120736739-120736761 CTGTGGACGGAGCGGGGAGCAGG + Intronic
1103425459 12:120830294-120830316 AGGGGGAAGGAGGGGGGAGGGGG + Intronic
1103563363 12:121803926-121803948 GCGAGGAAGGAGAGGGGAGGAGG + Intergenic
1103928423 12:124436338-124436360 CAGCTGAGGGAGAGAGGAGGTGG + Intronic
1103969401 12:124660657-124660679 CAGTGGCAGGAGGGGCGGGGAGG - Intergenic
1104004930 12:124885212-124885234 CGGTGGAGGGGGAAGGGAGGAGG - Intergenic
1104066829 12:125313558-125313580 AGGGGAAAGGAGAGGGGAGGGGG - Intronic
1104544466 12:129698652-129698674 GAGGGGGAGGGGAGGGGAGGGGG + Intronic
1104546216 12:129715214-129715236 CAGAGAAAGGTAAGGGGAGGAGG + Intronic
1104586330 12:130050993-130051015 CAGGGGACAGAGAGGAGAGGTGG - Intergenic
1104624372 12:130339242-130339264 CTGTGGAGGGAAAGGGGCGGCGG + Intronic
1104647173 12:130505654-130505676 TAGTGGGAGGGGAGTGGAGGGGG - Intronic
1104906444 12:132215852-132215874 CAGGGGATGGAGAGGGGGTGAGG + Intronic
1104975493 12:132550201-132550223 CAGGGGAGGGAGAGGGGCTGCGG + Intronic
1105007318 12:132729485-132729507 GAGGGGAAGGTGAGAGGAGGGGG + Intronic
1105007373 12:132729601-132729623 GAGGGGGAGGTGAGGGGAGGGGG + Intronic
1105446575 13:20462196-20462218 TAGTGGGAGGAGGGGGCAGGAGG + Intronic
1105541777 13:21322125-21322147 CAGGGGAGGAAGAGGAGAGGAGG - Intergenic
1105584329 13:21730162-21730184 AAGAGGAAGGAGATGGGAAGGGG - Intergenic
1105649994 13:22366632-22366654 CAGAGGTGGGAGAGGGTAGGGGG + Intergenic
1105810101 13:23987762-23987784 CAGGGGTTGGAGAGGGGAGTGGG - Intronic
1105865928 13:24459912-24459934 CAGTGGAGGGGGAGTGGTGGAGG - Intronic
1106208094 13:27618229-27618251 CAGTGGAAGGAGAAATGACGTGG - Intronic
1106360754 13:29028486-29028508 GAGTGGAAGGAGAGGAGGGCAGG - Intronic
1106458579 13:29948721-29948743 CGGTGGAAGGAGGTGGGAGGAGG - Intergenic
1107095077 13:36527287-36527309 CAGAGGAGGGAGAAGGGAGGTGG + Intergenic
1107389730 13:39951474-39951496 GGGTGGATGGGGAGGGGAGGGGG + Intergenic
1107554077 13:41502310-41502332 CCAGGGAAGGGGAGGGGAGGAGG - Intergenic
1107628786 13:42320511-42320533 CAGTGGGAGGAGGGGGGAGGGGG - Exonic
1107662219 13:42650437-42650459 ATGGGGAAGGGGAGGGGAGGAGG + Intergenic
1107697621 13:43015850-43015872 CAGTGGAAGGAGAGGGGAGGAGG - Intergenic
1107882294 13:44843268-44843290 GAGTGGGAGGAGAAGGGGGGTGG + Intergenic
1108026117 13:46179744-46179766 CAGTGGCGGGGGAGGGGATGGGG + Intronic
1108186116 13:47890063-47890085 CAGTGGAAAATGAGTGGAGGGGG - Intergenic
1108541436 13:51451459-51451481 TAGTGGAAGCAGATGGGAGCCGG + Intronic
1108542613 13:51457548-51457570 TAGTGGAAGGTGAGGCGATGAGG + Intergenic
1108748952 13:53426600-53426622 GAGGGGAAAGAGAGAGGAGGGGG - Intergenic
1108833427 13:54508275-54508297 CGGTAGAAGAAGAGGAGAGGAGG + Intergenic
1108938047 13:55911000-55911022 CCGTAAAAGGAGTGGGGAGGAGG - Intergenic
1110182373 13:72633129-72633151 TAGAGGAAGGAGAGAGGAAGAGG + Intergenic
1110680730 13:78309069-78309091 AAGTGGGAGGTGAGGGAAGGAGG + Intergenic
1110929170 13:81194123-81194145 CAGTGAAAGCAGCTGGGAGGGGG - Intergenic
1111711888 13:91826920-91826942 CAGAGGCAGGAAAGGGGAGTGGG + Intronic
1111912034 13:94323574-94323596 CACTGGAGGGAAAGGGTAGGAGG + Intronic
1111979852 13:95004095-95004117 CGGGGGAAGGAGGGGGGAGAAGG + Intergenic
1112362469 13:98730238-98730260 AAGGGGAAGGGGAGGGGAAGGGG + Intronic
1112362475 13:98730249-98730271 GAGGGGAAGGGGAGGGGAAGGGG + Intronic
1112362481 13:98730260-98730282 GAGGGGAAGGGGAGGGGAAGGGG + Intronic
1112362487 13:98730271-98730293 GAGGGGAAGGGGAGGGGAAGGGG + Intronic
1112362493 13:98730282-98730304 GAGGGGAAGGGGAGGGGAAGGGG + Intronic
1112374531 13:98826366-98826388 CAGAGGAAGGAGAGGGGGCGAGG - Intronic
1112441241 13:99426436-99426458 CAGTGGCAGGAGAGGGGTGCAGG - Intergenic
1112532206 13:100216064-100216086 AAGGGGAAGGGGAGGGGAAGGGG - Intronic
1112532215 13:100216081-100216103 AAGGGGAAGGAGAGGGGAAGGGG - Intronic
1112816751 13:103281825-103281847 AAATGAAAGGATAGGGGAGGGGG - Intergenic
1112825003 13:103382086-103382108 CTGTGAAAGGAGCTGGGAGGGGG - Intergenic
1112988634 13:105483040-105483062 GAGAGGAAGGAGAGGGAAAGGGG - Intronic
1113008266 13:105733307-105733329 CAGTGGCAGGAGGTGGGAAGAGG - Intergenic
1113072405 13:106434397-106434419 CAGGTGAAGGAAAGGGGAAGAGG - Intergenic
1113153928 13:107295642-107295664 GAGTGGGAGGAGGGTGGAGGAGG + Intronic
1113282122 13:108799863-108799885 AAGAGGAAGAAGAAGGGAGGAGG + Intronic
1113472091 13:110554413-110554435 GACTGGAAGGAGAGAGGTGGGGG + Intronic
1113673969 13:112195787-112195809 GAGGGGAAGGAGGGGGGAGGAGG - Intergenic
1113909714 13:113836325-113836347 AAGAGGAGGGGGAGGGGAGGAGG + Intronic
1113927084 13:113947593-113947615 CAGTGGGTGGAGCGGGGAGCTGG + Intergenic
1113927368 13:113949206-113949228 CAGTGAAGAGAGTGGGGAGGTGG - Intergenic
1114626798 14:24135816-24135838 CAGGGGAAGAAGAGAGCAGGTGG + Intergenic
1114630410 14:24155876-24155898 GAGGGAAAGGAAAGGGGAGGAGG + Intronic
1114712335 14:24791272-24791294 CAGAGGATGGGGAGGGTAGGGGG + Intergenic
1115389789 14:32841975-32841997 GAGGGGAGGGGGAGGGGAGGGGG - Intergenic
1115498183 14:34027231-34027253 GAGGGGGAGGAGAGAGGAGGAGG + Intronic
1115498192 14:34027250-34027272 GAGGGGGAGGAGAGGGGAGGAGG + Intronic
1115498202 14:34027272-34027294 GAGGGGGAGGAGAGGGGAGGAGG + Intronic
1115498274 14:34027413-34027435 GAGGGGAAGGGGAGGGGAGGGGG + Intronic
1115612489 14:35062028-35062050 AACTGGAAGCTGAGGGGAGGGGG + Intronic
1116458032 14:45141508-45141530 AGGAGGAAGGGGAGGGGAGGGGG - Intronic
1116809105 14:49522313-49522335 CAGTGGAAATAGAGGGGTGAAGG + Intergenic
1117649068 14:57883039-57883061 GAGGAGAAGGGGAGGGGAGGAGG + Intronic
1117761656 14:59035413-59035435 GAGGGGGAGGAGGGGGGAGGAGG - Intergenic
1118072991 14:62266292-62266314 CTGTGGAAGGAAAAGGAAGGAGG - Intergenic
1118554655 14:67003566-67003588 TAGTGGAAGGTAAAGGGAGGAGG + Intronic
1118974554 14:70665449-70665471 GAGAGGGAGGAGAGGGGAGGGGG + Intronic
1119134030 14:72200549-72200571 GAGTGGAGGGAGAAGGGATGAGG + Intronic
1119182167 14:72612592-72612614 CAGGGAAGGGAGAGGGCAGGAGG + Intergenic
1119437814 14:74609639-74609661 GTGGGGAAGCAGAGGGGAGGTGG - Intronic
1119443776 14:74647303-74647325 CAGAGGAAGGAGAAGGGAGTCGG - Intergenic
1119485598 14:74984775-74984797 CAGCGGAAGGAGTGGGGATGGGG + Intergenic
1119544001 14:75458913-75458935 ACGTGGCTGGAGAGGGGAGGAGG + Intronic
1119575842 14:75721201-75721223 GAGTGGAAGGGGAGGAGAAGAGG - Intronic
1119600180 14:75970646-75970668 GAGGGGAAGAGGAGGGGAGGTGG - Intronic
1119616225 14:76100743-76100765 CAGGGGCAGGAGAGGGGGTGCGG + Intergenic
1119804774 14:77475552-77475574 CACTGCAGGGAGAGGGCAGGCGG - Exonic
1119925390 14:78488782-78488804 GAGGGGGAGGAGAAGGGAGGAGG + Intronic
1119931437 14:78551576-78551598 AAGGGAAATGAGAGGGGAGGAGG - Intronic
1119996851 14:79262537-79262559 GAAAGGAAGGAGAGAGGAGGAGG + Intronic
1120480030 14:85038026-85038048 CAGTGCAAGGAGGTGGGTGGGGG - Intergenic
1120917290 14:89721250-89721272 CAGCTTAAGGAGAGGGGAGAGGG - Intergenic
1121050482 14:90816429-90816451 CTGGGGAAGGGGCGGGGAGGCGG + Intronic
1121431554 14:93891720-93891742 CAGGTGAAGGAGAGGAGAGGGGG - Intergenic
1121744046 14:96274109-96274131 CAGGGGAGGGAGCGGGCAGGTGG + Intergenic
1122047488 14:99034419-99034441 AAGGGGAAAGAAAGGGGAGGGGG + Intergenic
1122059910 14:99130126-99130148 CAGGGGAAGGAGAGGGCGTGGGG - Intergenic
1122102524 14:99424677-99424699 CAGAGGGAGGGGAGGAGAGGAGG + Intronic
1122126261 14:99580166-99580188 CAGAGGAAGGAGAGGCTGGGTGG + Intronic
1122283274 14:100636741-100636763 CAGGGGAAGGAGCAGGGAGTGGG - Intergenic
1122308250 14:100779021-100779043 CTGTGGTAGGAGAGGGAGGGAGG - Intergenic
1122444447 14:101759164-101759186 CGGTGGCAGGAGTGTGGAGGAGG - Intergenic
1122557650 14:102590341-102590363 AGGTGTAAGGAGAGGGGAGCAGG + Intergenic
1122558188 14:102592612-102592634 CAGCGAGCGGAGAGGGGAGGAGG - Intergenic
1122652193 14:103232075-103232097 CAGTAGAGGGAGAGGGGACCCGG - Intergenic
1122703345 14:103605063-103605085 AAGTGGGTGGAGAGGGGGGGTGG - Intronic
1122888665 14:104722884-104722906 CAGTGGAAGAAGAGGGGACTGGG + Intergenic
1202900765 14_GL000194v1_random:35820-35842 CATAGGAGTGAGAGGGGAGGAGG - Intergenic
1202918067 14_KI270723v1_random:3295-3317 CAGGGGCAGGGCAGGGGAGGAGG - Intergenic
1202926558 14_KI270724v1_random:31291-31313 CAGGGGCAGGGCAGGGGAGGAGG + Intergenic
1123450851 15:20358105-20358127 CAGGGGAGGAAGAGGGGAGGAGG + Intergenic
1123932438 15:25178350-25178372 CCATGGAAGGACAGGGCAGGTGG - Intergenic
1123935683 15:25192936-25192958 CCCTGGAAGGACAGGGCAGGTGG - Intergenic
1123936634 15:25197187-25197209 CCCTGGAAGGATAGGGCAGGTGG - Intergenic
1123938591 15:25205887-25205909 CCCTGGAAGGAAAGGGCAGGTGG - Intergenic
1124177384 15:27439083-27439105 CATTAGAAGTAGAGAGGAGGAGG - Intronic
1124220537 15:27846758-27846780 CAGGGAAAGGAATGGGGAGGAGG + Intronic
1124427141 15:29571221-29571243 CTGCGGAAGGAGAGCGGGGGCGG + Intergenic
1124725545 15:32152968-32152990 CAGGGGACGGAGAGGGGCAGTGG + Intronic
1124866708 15:33499303-33499325 GAGTGGCAGGAGGGAGGAGGGGG - Intronic
1124918267 15:33998007-33998029 AAGTGGAAGGAGAGAGCAGAAGG - Intronic
1124957865 15:34371238-34371260 GAGGAGAAGGAGATGGGAGGGGG - Intergenic
1125280993 15:38042646-38042668 CAGTGGGAGGATGGGAGAGGAGG + Intergenic
1125295087 15:38194034-38194056 CAATGGAAGGCCAGGTGAGGTGG + Intergenic
1125400899 15:39301663-39301685 CAGGGGCAGGGGATGGGAGGAGG + Intergenic
1125447757 15:39776166-39776188 CAGAGGGAGGGGAGGGGCGGAGG + Intronic
1125674158 15:41493769-41493791 AAGTGGAAGGAGTGGGCGGGGGG + Intronic
1125697676 15:41652368-41652390 CGGGGAAAGGAGAGGGGAGAGGG - Intronic
1125833653 15:42733017-42733039 CGGTGGCAGGAGGGAGGAGGAGG - Intronic
1125861372 15:43004350-43004372 GAGAGGAGGGAGAGGAGAGGAGG - Intronic
1126778589 15:52119536-52119558 AGGTGGAGGGAGAAGGGAGGGGG + Exonic
1126860421 15:52877566-52877588 TGGAGGAAGGGGAGGGGAGGAGG - Intergenic
1126932383 15:53669041-53669063 AAGGGGAAGGGGAGGGGAAGGGG + Intronic
1127099513 15:55550900-55550922 CAGTGGTGGGGGATGGGAGGTGG + Intronic
1127260812 15:57324626-57324648 CAGAAGAATGTGAGGGGAGGAGG - Intergenic
1127507589 15:59610955-59610977 GAGGGGGAGGGGAGGGGAGGGGG - Intronic
1127507599 15:59610971-59610993 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
1127507606 15:59610982-59611004 GAGGGGGAGGGGAGGGGAGGGGG - Intronic
1127507616 15:59610998-59611020 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
1127507623 15:59611009-59611031 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
1127507711 15:59611178-59611200 AAGGGGGAGGGGAGGGGAGGGGG - Intronic
1127620020 15:60724894-60724916 CAGTGTGAGGAGCGGGGAGGAGG - Intronic
1127628244 15:60801266-60801288 CTGTCGAAGGAGGGGGGAGGGGG - Intronic
1127649750 15:60995480-60995502 GGGAGGAAGGGGAGGGGAGGAGG - Intronic
1127866973 15:63041468-63041490 CAGTGGGAGGGGAGGAGAGGGGG - Intergenic
1127867220 15:63042593-63042615 CCGCGGGAGGAGCGGGGAGGGGG + Intergenic
1127996475 15:64155896-64155918 CTGTGGAATGTGAGGGGAGTGGG + Exonic
1128107574 15:65055898-65055920 CAGAGGCAGGAGAGGGCAGGGGG + Intronic
1128146141 15:65333419-65333441 CAGAGGAAGGGGAGGGGGGATGG + Intronic
1128352191 15:66898642-66898664 CAGTGGCAGGTGTGGGGCGGGGG - Intergenic
1128454577 15:67825434-67825456 CAGTGCAAGGAGGGGTGGGGAGG - Intronic
1128549399 15:68588507-68588529 CTGTGGAAGGCGAGGGAAGGTGG + Intronic
1128683134 15:69665908-69665930 CAGTGGGAGGAGAGAGGGGCTGG + Intergenic
1128758020 15:70196401-70196423 CAGTGGCAGGCCAGGGGAGGAGG - Intergenic
1128778261 15:70340538-70340560 ATGTGGAAGGAGAGGGAAAGTGG - Intergenic
1128793183 15:70448001-70448023 CTGCGGGAGGAGAGGGGAAGGGG + Intergenic
1128916156 15:71564441-71564463 CAGTTGAAGAAGATTGGAGGTGG + Intronic
1129067149 15:72914802-72914824 CTGTGGAAGGAGAAGGCAGAAGG - Intergenic
1129199914 15:73992481-73992503 GAGTAGGAGAAGAGGGGAGGAGG - Intronic
1129322454 15:74782569-74782591 GGGTGCAAGGAGAGGGGAGGAGG - Exonic
1129442153 15:75589024-75589046 GAGTGGGAGGGGAGGGGAGAGGG + Intergenic
1129657471 15:77533750-77533772 CTGGGGAAGGGAAGGGGAGGAGG - Intergenic
1129667978 15:77590147-77590169 CAGGGGCAGGAGGGGTGAGGGGG + Intergenic
1129683719 15:77672555-77672577 CAGTGAAGTGAGAGGTGAGGAGG - Intronic
1129702562 15:77776131-77776153 CAGGGGGAGGAGCTGGGAGGGGG - Intronic
1129830872 15:78669158-78669180 CCTGGGAGGGAGAGGGGAGGAGG + Intronic
1129989194 15:79947427-79947449 CATTGGAGGGAGAGGAGAGAAGG + Intergenic
1130155835 15:81349278-81349300 AAGAGGAGGGATAGGGGAGGAGG - Intronic
1130577790 15:85107583-85107605 CAGTGGAAGGAGAGGGGAGGGGG + Intronic
1130688831 15:86062671-86062693 CAGGAGAAGGAAAGAGGAGGAGG - Intergenic
1130894913 15:88162460-88162482 CAGCAGAAGGAGAGGGGAGAAGG + Intronic
1130959800 15:88652333-88652355 GAGGGGGAGGAGGGGGGAGGAGG - Intronic
1131131696 15:89904563-89904585 CAGGGCCAGGAGAGAGGAGGGGG - Intronic
1131157048 15:90081744-90081766 CACTGGCAGGAGGGAGGAGGAGG - Exonic
1131290374 15:91101581-91101603 CAGTGAGAGCAGAGAGGAGGAGG + Intronic
1131609031 15:93941453-93941475 CAATGGAAAGTGAGGGGAGCTGG + Intergenic
1131646242 15:94348389-94348411 GAGGGGATGGAGAGGGAAGGGGG - Intronic
1131832875 15:96365592-96365614 CTGTGGACGGAGTGGGGTGGGGG - Intergenic
1131862646 15:96670569-96670591 CAGCAGAAGGAGTTGGGAGGAGG + Intergenic
1132120059 15:99168763-99168785 CAGTGGAGGAGGAGGAGAGGAGG - Intronic
1132238912 15:100242538-100242560 GAGAGGATGGAGAGAGGAGGGGG - Intronic
1132389368 15:101427347-101427369 AAGTGGAAAGACGGGGGAGGCGG + Intronic
1132549848 16:549869-549891 CGTTGGGAGGAGAGGCGAGGCGG + Intronic
1132550955 16:553666-553688 GAGGGGAAGGAGGGGGGCGGGGG - Exonic
1132555837 16:572286-572308 CAGTGGTCAGAGAGGGCAGGCGG - Intronic
1132664770 16:1076331-1076353 GGGTGGGAGAAGAGGGGAGGTGG - Intergenic
1132688043 16:1170446-1170468 CAGAGGCAGGGGAGGGGAGCGGG + Intronic
1132829982 16:1923239-1923261 GAGGGGATGGAGAGGGGAAGAGG + Intergenic
1132846184 16:2001914-2001936 CAGTGGGAAGGGAGAGGAGGAGG + Intronic
1132993097 16:2807526-2807548 AACTGGAAGGAGAGTGGAGCTGG + Intergenic
1133002513 16:2858350-2858372 CTCTGGAAGGGCAGGGGAGGGGG + Intergenic
1133036064 16:3035108-3035130 CAAGGGAAGGAGAGAGGAGCTGG - Intronic
1133046053 16:3088978-3089000 AAGTGGAAGGAGAGGGAAGTGGG + Exonic
1133151896 16:3839704-3839726 GAAGGGAAGGGGAGGGGAGGGGG + Intronic
1133212825 16:4272619-4272641 CAGTGGTAGGAAGGGGGTGGGGG + Intronic
1133333070 16:4988123-4988145 CAAGGGAAGGGGCGGGGAGGCGG - Intronic
1133897610 16:9944414-9944436 CAGAGGAAGGGGGAGGGAGGTGG - Intronic
1134449414 16:14354256-14354278 AAGGGGAAGGGGAGGGTAGGAGG + Intergenic
1134493330 16:14712316-14712338 GAGGGGAAGGGGAGGGGAAGGGG - Intronic
1134498711 16:14751440-14751462 GAGGGGAAGGGGAGGGGAAGGGG - Intronic
1134525265 16:14938070-14938092 GAGGGGAAGGGGAGGGGAAGGGG - Intronic
1134547621 16:15122827-15122849 GAGGGGAAGGGGAGGGGAAGGGG + Intronic
1134547627 16:15122838-15122860 GAGGGGAAGGGGAGGGGAAGGGG + Intronic
1134581865 16:15377651-15377673 AAGGGGAAGGGGAGGGGAAGGGG + Intronic
1134674454 16:16079604-16079626 CAGTGGAAAGATACAGGAGGAGG - Intronic
1134712853 16:16336554-16336576 GAGGGGAAGGGGAGGGGAAGGGG - Intergenic
1134720724 16:16379883-16379905 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
1134774115 16:16837087-16837109 GGGGGAAAGGAGAGGGGAGGGGG + Intergenic
1134777381 16:16864975-16864997 CAGGGGAAGGGGTAGGGAGGAGG - Intergenic
1134946703 16:18332002-18332024 GAGGGGAGGGGGAGGGGAGGGGG + Intronic
1134953962 16:18372117-18372139 GAGGGGAGGGGGAGGGGAGGGGG + Intergenic
1134953974 16:18372139-18372161 GAGGGGAAGGGGAGGGGAAGGGG + Intergenic
1134995125 16:18733720-18733742 AGGGGGAGGGAGAGGGGAGGGGG - Intergenic
1135091564 16:19522019-19522041 CAGTAGAACGAGAAGCGAGGGGG + Exonic
1135235748 16:20754177-20754199 CAGTGAAATAAGAGGGGAGAAGG + Intronic
1135312795 16:21419013-21419035 GAGGGGAAGGGGAGGGGAAGGGG + Intronic
1135365699 16:21851260-21851282 GAGGGGAGGGGGAGGGGAGGGGG + Intronic
1135365706 16:21851271-21851293 GAGGGGAGGGGGAGGGGAGGGGG + Intronic
1135365718 16:21851293-21851315 GAGGGGAAGGGGAGGGGAAGGGG + Intronic
1135446096 16:22519869-22519891 GAGGGGAAGGGGAGGGGAAGGGG - Intronic
1135620297 16:23950000-23950022 CAATGCAAGGAGAGGGAAGGAGG - Intronic
1135624314 16:23981852-23981874 AAGGGGAAGGGGAGGGGAAGGGG - Intronic
1135624328 16:23981880-23981902 AAGGGGAAGGGGAGGGGAAGGGG - Intronic
1136033318 16:27519235-27519257 CTGGGGAAGGGGAGGGGAGAGGG + Intronic
1136074819 16:27809788-27809810 CAGTGGAAAGACAGGGAGGGTGG - Intronic
1136151926 16:28356713-28356735 CAGGGGAGGGGGAGGGGAAGGGG + Intronic
1136151955 16:28356764-28356786 AAGGGGAAGGGGAGGGGAAGGGG + Intronic
1136160249 16:28415170-28415192 CAGTGGAGAGGGCGGGGAGGGGG - Intergenic
1136168192 16:28470602-28470624 AAGGGGAAGGGGAGGGGAAGGGG + Intronic
1136168199 16:28470613-28470635 GAGGGGAAGGGGAGGGGAGGGGG + Intronic
1136168211 16:28470635-28470657 GAGGGGAAGGGGAGGGGAAGGGG + Intronic
1136202839 16:28700120-28700142 CAGTGGAGAGGGCGGGGAGGGGG + Intronic
1136211123 16:28758518-28758540 AAGGGGAAGGGGAGGGGAAGGGG - Intronic
1136211152 16:28758569-28758591 CAGGGGAGGGGGAGGGGAAGGGG - Intronic
1136255857 16:29038493-29038515 GAGGGGAAGGGGAGGGGAAGGGG - Intergenic
1136255873 16:29038521-29038543 CAGGGGAGGGGGAGGGGAAGGGG - Intergenic
1136322908 16:29499521-29499543 GAGGGGAAGGGGAGGGGAAGGGG + Intronic
1136437592 16:30239489-30239511 GAGGGGAAGGGGAGGGGAAGGGG + Intronic
1136656501 16:31712362-31712384 CAGTGCCGGGAGAGTGGAGGAGG + Intergenic
1137000132 16:35222123-35222145 CAGGGGCAGGAAAGGGGAGGAGG - Intergenic
1137033165 16:35543839-35543861 CAGGGGAAGAGCAGGGGAGGAGG - Intergenic
1137327006 16:47450098-47450120 CTGTGGAAGGAGCGGAGTGGTGG + Intronic
1137620950 16:49876461-49876483 GGGAGGAAGGAGAGGGGAGGAGG + Intergenic
1137697395 16:50470208-50470230 CAGTGGGCGGATGGGGGAGGGGG + Intergenic
1137725885 16:50656319-50656341 CAGTGGAAGGTGAAGGGGAGCGG - Intergenic
1137788280 16:51154285-51154307 CCGGGAAAGGAGATGGGAGGTGG + Intergenic
1137888092 16:52128075-52128097 AAGATGAAGGAGAGGGGATGGGG + Intergenic
1137990638 16:53151215-53151237 GAGAGGAAAGGGAGGGGAGGGGG - Intronic
1138143246 16:54586403-54586425 CAGTGGAAGGAAGTGGGGGGTGG + Intergenic
1138395160 16:56698408-56698430 CACTGGAGGGACAGTGGAGGAGG - Intronic
1138413916 16:56860351-56860373 CAGAGGAAGGAGAGGGGAGAGGG - Intergenic
1138423456 16:56914877-56914899 AGGTGAAAGGAGAGGGGAGGAGG + Exonic
1138455168 16:57116833-57116855 TAGAGGCAGGAGAGGAGAGGAGG + Intronic
1138605850 16:58088324-58088346 CAGCTGGAGGAGAGGGGTGGAGG - Intergenic
1138615023 16:58158354-58158376 CTGGGGAAAGAGACGGGAGGAGG + Intronic
1138618085 16:58188038-58188060 GTGGGGAAGGGGAGGGGAGGGGG + Intronic
1138650642 16:58459056-58459078 CAGCAGATGGAGATGGGAGGCGG - Intergenic
1138667732 16:58586331-58586353 GAGGGGAAGGGGAGGGGAGGGGG + Intronic
1139055527 16:63179074-63179096 GAGTGAAAGGAGAGGGGGGGGGG + Intergenic
1139365464 16:66429677-66429699 CAGAGGAAGAAGAGGAGAGAGGG - Intronic
1139376626 16:66502765-66502787 CTGTGGAAGGAGGGGGGAAGGGG - Intronic
1139470565 16:67175991-67176013 CAGTGGAGGGAGTGGGGAACAGG + Exonic
1139471075 16:67178507-67178529 GCGGGGAAGGCGAGGGGAGGCGG + Intronic
1139701553 16:68710961-68710983 GAGGGGAAGGAGGGGGGAGGGGG + Intronic
1139766715 16:69236745-69236767 CAGTGGAAACTGAGGGGAGTAGG + Intronic
1139857149 16:69990142-69990164 GAGGGGAAGGGGAGGGGAAGGGG + Intergenic
1140365538 16:74377806-74377828 GAGGGGAGGGGGAGGGGAGGGGG - Intergenic
1140365545 16:74377817-74377839 GAGGGGAGGGGGAGGGGAGGGGG - Intergenic
1140365552 16:74377828-74377850 GAGGGGAGGGGGAGGGGAGGGGG - Intergenic
1140365559 16:74377839-74377861 GAGGGGAGGGGGAGGGGAGGGGG - Intergenic
1140419285 16:74804931-74804953 GAGGGGAGGGACAGGGGAGGGGG - Intergenic
1141005109 16:80344701-80344723 CCGTGCTAGGAGAGGGTAGGAGG + Intergenic
1141125260 16:81396602-81396624 GGGAGCAAGGAGAGGGGAGGTGG + Intergenic
1141140266 16:81492781-81492803 ATGTGGAAGAGGAGGGGAGGCGG + Intronic
1141167432 16:81669743-81669765 GTGTGGAAGGAGAAGAGAGGTGG - Intronic
1141435722 16:83998741-83998763 CTGAGGAAGGAGAGGAGAGTCGG + Intronic
1141575859 16:84963282-84963304 CTGGGGGAGGCGAGGGGAGGAGG - Intergenic
1141659718 16:85435428-85435450 CAGTCGAGGGAGAGGGAGGGAGG - Intergenic
1141738391 16:85871601-85871623 AAGAGAAAGGAGAGGAGAGGAGG - Intergenic
1141900379 16:86986937-86986959 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
1141900389 16:86986953-86986975 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
1141989716 16:87602863-87602885 GAGGGGAGGGGGAGGGGAGGAGG - Intronic
1142018487 16:87765486-87765508 GGGTGGAGGGAGAAGGGAGGAGG + Intronic
1142090850 16:88208455-88208477 GAGTGTAAGGGGAGGAGAGGAGG + Intergenic
1142139530 16:88466586-88466608 CAGTGGGAGGGGATGGGCGGAGG + Intronic
1142160445 16:88554812-88554834 CAGCGGAAGGAGTAGGGAGGAGG - Intergenic
1142273693 16:89104601-89104623 CAGGAGAAGCAGAGGGAAGGTGG - Intronic
1142470551 17:161125-161147 AAGAGGGAGGAGAGGGCAGGAGG - Intronic
1142480474 17:215613-215635 CGGGGGCAGGAGAGGGGAGAAGG + Intronic
1142566998 17:846704-846726 AAGTGGAGGGAAAGGGGAAGGGG + Intronic
1142787532 17:2235852-2235874 GTGTGGAAGTAGAGGGGAGAAGG - Intronic
1142788314 17:2243044-2243066 CAGTGGCAGGACGGGGGAGGTGG + Intronic
1142910022 17:3081017-3081039 CAGGGGAGAGAGAGGGGCGGGGG + Intergenic
1143331849 17:6143161-6143183 CAATGGAAGGAGAGGTCAGAAGG - Intergenic
1143377253 17:6474096-6474118 CAGGAGAAGGAGAGGGTGGGAGG + Intronic
1143391325 17:6560943-6560965 AAGAGGAGGAAGAGGGGAGGAGG - Intergenic
1143391332 17:6560966-6560988 AGGAGGAAGAAGAGGGGAGGAGG - Intergenic
1143391390 17:6561173-6561195 AAGAGGAGGGGGAGGGGAGGAGG - Intergenic
1143391400 17:6561196-6561218 AAGAGGAGGGGGAGGGGAGGAGG - Intergenic
1143391526 17:6561648-6561670 AAGAGGAGGGGGAGGGGAGGAGG - Intergenic
1143515689 17:7418224-7418246 AGGGGGAGGGAGAGGGGAGGAGG - Exonic
1143594690 17:7907270-7907292 CTGTGGAGCGGGAGGGGAGGGGG + Intronic
1143704243 17:8686133-8686155 CAGTGTAAGGAGGGGTGAAGAGG - Intergenic
1143715877 17:8768689-8768711 AAGTGGAGGGAAAGGGGAAGGGG - Intergenic
1143887500 17:10076104-10076126 GAGGGGAAGGAGAGGGGAAAGGG + Intronic
1144131374 17:12250538-12250560 AAGTGGAGGGAAATGGGAGGGGG - Intergenic
1144179076 17:12734974-12734996 CCGTGCAAGGACAGGGCAGGGGG - Intronic
1144257761 17:13486464-13486486 CAGAGGCAGGAGAAGGCAGGAGG + Intergenic
1144319791 17:14103638-14103660 GGGTGGGATGAGAGGGGAGGAGG - Intronic
1144328969 17:14207228-14207250 CAGCGGAGGGAAAGGGGCGGTGG - Exonic
1144329448 17:14211120-14211142 CAGTGGCAGTGGAGGGGGGGTGG - Intergenic
1144643510 17:16952767-16952789 CTGAGGCTGGAGAGGGGAGGTGG - Intronic
1144946728 17:18973190-18973212 CATTGGGAGGAGGTGGGAGGTGG - Intronic
1145205241 17:20981309-20981331 CTGAGGCTGGAGAGGGGAGGTGG + Intergenic
1145312615 17:21708747-21708769 CAGGGGAAGGATAGGGGAGAGGG + Intergenic
1145416012 17:22714736-22714758 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
1145883373 17:28367310-28367332 TGGGGGAAGGAGATGGGAGGAGG + Exonic
1145965409 17:28913281-28913303 CAATGGAAGGAGAGGAGAGGGGG + Intronic
1146054704 17:29575260-29575282 GAGTGGAGGGGGAGGTGAGGGGG - Intronic
1146200425 17:30852713-30852735 AAGTGGCAAGAGAGAGGAGGAGG + Intronic
1146535822 17:33650833-33650855 GAGTGGAAGGAAAGGGGCTGTGG + Intronic
1146559159 17:33853223-33853245 CTAAGGAGGGAGAGGGGAGGTGG + Intronic
1146632581 17:34481496-34481518 CACTGCAAGAAGAGGGCAGGCGG - Intergenic
1146649833 17:34599816-34599838 TGGTGGAGGGAGTGGGGAGGGGG + Intronic
1146686015 17:34842123-34842145 GAGAGGAAGGTTAGGGGAGGGGG - Intergenic
1147051987 17:37802170-37802192 CAGAGCAAGGAGAGGGGGAGAGG - Intergenic
1147150414 17:38510757-38510779 GAGTGGAAGGAGCTGGGCGGAGG + Exonic
1147210460 17:38870033-38870055 TAGGGGAAGGAGGGCGGAGGCGG + Exonic
1147598860 17:41733842-41733864 CAGTGCCAGGAGAGGGGCGGGGG - Intronic
1147650184 17:42057601-42057623 CATTGGGAGGAGAGGCAAGGGGG + Intronic
1147673483 17:42190084-42190106 GATGGGAAGGAGAGGGGTGGCGG - Intronic
1147699373 17:42383025-42383047 CAGAGGAAGGAGAGGTTATGAGG - Intronic
1147911618 17:43859426-43859448 CAGTGGAGGCAGAGGGGCAGGGG + Intronic
1148162075 17:45455959-45455981 GAGTGGCAGGAGAGAGGAGATGG - Intronic
1148195285 17:45708657-45708679 CCTTGGAAGGAGAGGGGGAGTGG + Intergenic
1148440969 17:47711431-47711453 CAGTGGAAGAAGGGTTGAGGGGG - Exonic
1148489211 17:48012506-48012528 CGGAGGAGGGAGGGGGGAGGGGG - Intergenic
1148770664 17:50064196-50064218 CAGTGAAAAGTGAGGGGAAGGGG + Exonic
1148775740 17:50095002-50095024 CAGGTGAAGGAGATGCGAGGGGG + Intronic
1149315184 17:55431961-55431983 AAGGGGAAGGGGAGTGGAGGGGG + Intergenic
1149583572 17:57768701-57768723 CAGGGGAAGGAGAGTGGGGTGGG + Intergenic
1149850039 17:60028701-60028723 CGGGTGAAGGAGAGGAGAGGCGG + Intergenic
1149860128 17:60117823-60117845 CGGGTGAAGGAGAGGAGAGGCGG - Intergenic
1150124617 17:62628084-62628106 GCGGGGGAGGAGAGGGGAGGAGG + Intronic
1150138535 17:62709584-62709606 TAGATGAAGGAGAGGGAAGGAGG + Intronic
1150369545 17:64624826-64624848 GGAGGGAAGGAGAGGGGAGGGGG + Intronic
1150393308 17:64802607-64802629 GAGTGGCAGGAGAGAGGAGATGG - Intergenic
1150784656 17:68152622-68152644 TAAGGGGAGGAGAGGGGAGGGGG - Intergenic
1150964180 17:69948495-69948517 AAGGAGGAGGAGAGGGGAGGGGG + Intergenic
1151145233 17:72034405-72034427 CTGTGGATGGGGAGAGGAGGGGG - Intergenic
1151194991 17:72424973-72424995 CAGTGCAGGGAGAGAGGTGGAGG - Intergenic
1151285668 17:73109238-73109260 CAGGGGATGGGGATGGGAGGTGG - Intergenic
1151305853 17:73262295-73262317 CATGGGAAGAAGCGGGGAGGTGG - Intronic
1151354267 17:73549214-73549236 GAGTAGAAGGAGAGAGGAGTGGG + Intronic
1151379747 17:73717561-73717583 CGGTGGGGGGAGGGGGGAGGTGG - Intergenic
1151623870 17:75264294-75264316 CAGAAGAAGGCGAAGGGAGGTGG - Intronic
1151666135 17:75546116-75546138 GAGGGGATGGGGAGGGGAGGCGG + Intronic
1151827084 17:76529664-76529686 CAGGGGAAGAGGAGGGGAGGGGG - Intronic
1151969232 17:77449409-77449431 CAGAGGCAGAGGAGGGGAGGAGG + Intronic
1152069626 17:78128333-78128355 CACGGGGAGGGGAGGGGAGGGGG - Intronic
1152085654 17:78216573-78216595 CTGTGGAGGGCGTGGGGAGGTGG + Intronic
1152168856 17:78729889-78729911 CTGTGGAAAGAGAGTGGGGGAGG + Intronic
1152244759 17:79179534-79179556 TATTGTAAGGGGAGGGGAGGGGG - Intronic
1152337590 17:79707230-79707252 CAGGGGAGGAAGAAGGGAGGAGG - Intergenic
1152352920 17:79793382-79793404 CACGGGAAGGAGGGGCGAGGCGG - Exonic
1152613946 17:81329472-81329494 CAGAGGAGGGAGGAGGGAGGAGG + Intronic
1152800792 17:82329839-82329861 CAGGAGAGGGAGAGAGGAGGGGG - Intronic
1152900648 17:82939256-82939278 CAGTGGAAGGCGTCAGGAGGAGG - Intronic
1153125533 18:1785855-1785877 CAGTGAAGGGAGATAGGAGGGGG + Intergenic
1153474018 18:5477360-5477382 CAGTGGAATGAAGGGGGAGAGGG + Intronic
1153711269 18:7802089-7802111 CAGAGAAGGGAGAGGGGAGAAGG - Intronic
1153778982 18:8477950-8477972 CAGTGGAAGCAGCAGGAAGGTGG + Intergenic
1153807041 18:8717724-8717746 CTGTAGAATGGGAGGGGAGGGGG + Intronic
1153961372 18:10142908-10142930 TGGTGGCAGGAGAGGGGATGAGG - Intergenic
1154028425 18:10727696-10727718 CAGTGGAGGGAGTGGGGACAGGG - Intronic
1154503188 18:15006586-15006608 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
1155061617 18:22233635-22233657 GGGTGGTAGGGGAGGGGAGGAGG + Intergenic
1155584664 18:27351379-27351401 GAGTGGAAGGAGGGAGGAAGAGG + Intergenic
1155611136 18:27669155-27669177 CAGTGGGAGGGGAGGGCAAGTGG - Intergenic
1155707675 18:28837156-28837178 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
1155917779 18:31572980-31573002 GAGAGGAAAGAGAGGGAAGGAGG + Intergenic
1155923577 18:31630044-31630066 AAGAGGAAGAAGGGGGGAGGGGG + Intronic
1156149515 18:34224947-34224969 TGGGGGAAGGAGAGGGGAGTGGG - Intronic
1156291484 18:35751910-35751932 CTGTGGAAGGAGGGTGGTGGTGG + Intergenic
1156487880 18:37478106-37478128 CAGGGAGAGGAGAGGAGAGGGGG - Intronic
1156551403 18:38022736-38022758 CAGTGGAGGGAGGGAGGATGAGG - Intergenic
1157214701 18:45773176-45773198 AAGGAGAAGGAGAGGGAAGGAGG - Intergenic
1157253397 18:46116113-46116135 GAAGGGAAGGGGAGGGGAGGGGG + Intronic
1157327783 18:46681385-46681407 CAGTGGGAGATGAGAGGAGGGGG - Intronic
1157331189 18:46704962-46704984 GCTGGGAAGGAGAGGGGAGGAGG + Intronic
1157395061 18:47334592-47334614 GAGTGGCAGGAGAGGTGGGGAGG + Intergenic
1157412715 18:47477018-47477040 CAGTGGTAGGGGCGGGGTGGGGG - Intergenic
1157470270 18:47983138-47983160 GGGGGGAAGGAAAGGGGAGGAGG - Intergenic
1157481844 18:48060227-48060249 CAGGGGAAGCAGAGGGGAGAAGG + Intronic
1157507460 18:48238824-48238846 CTGTGGCAGGAGGGGAGAGGTGG + Intronic
1157559531 18:48636794-48636816 GAGAGGTGGGAGAGGGGAGGGGG + Intronic
1157605317 18:48922771-48922793 CTGTGGAAGGAGGGGAGAGAGGG - Intronic
1157893212 18:51438635-51438657 CAGAGGCAGGAGAGGGCAGGAGG + Intergenic
1157978505 18:52353421-52353443 CAGAGGAGGGAGGGAGGAGGAGG - Intronic
1158410779 18:57203966-57203988 CAGTGGAAAGAGAGATAAGGGGG + Intergenic
1158424463 18:57326649-57326671 CTGGGGAAGGAGAGGCAAGGAGG + Intergenic
1158610394 18:58935182-58935204 GAGGAGGAGGAGAGGGGAGGAGG - Intronic
1158610400 18:58935198-58935220 GAGGAGAAGGAGAGGGGAGGAGG - Intronic
1158796882 18:60856949-60856971 CGGTGGGGGGAGAGGGGAGGAGG - Intergenic
1158819728 18:61145599-61145621 CTGTGGTAGGGGGGGGGAGGGGG + Intergenic
1159508818 18:69369376-69369398 CAGAGGAAGGTGGGGGGAGGGGG + Intergenic
1159623526 18:70667359-70667381 GAGGGGAGGGGGAGGGGAGGGGG - Intergenic
1159972934 18:74676333-74676355 CTTTGGAAGGAGAAGGCAGGCGG - Intronic
1160002047 18:75033864-75033886 CAGGGAAAGGAGAAGGGAAGAGG - Intronic
1160265290 18:77336503-77336525 CAGTGGGAGGAGGTGGAAGGGGG + Intergenic
1160322061 18:77905518-77905540 AGGTGGAAGGGGAGGGAAGGGGG + Intergenic
1160375798 18:78410577-78410599 CAGGGCAGGGAGAGGAGAGGTGG - Intergenic
1160453223 18:78979369-78979391 CAGGGGAGGGAGAGGAGGGGAGG + Intergenic
1160498824 18:79392331-79392353 CAGAGGGAGGAGAGGGGACCGGG + Intergenic
1160726755 19:620891-620913 CAGGGGAGGGGGAGGGGAGGAGG + Intronic
1160726774 19:620932-620954 CAGGGGAGGGGGAGGGGAGGAGG + Intronic
1160736594 19:665430-665452 CAGGGGAAGGAGAGGGGACTTGG - Intergenic
1160758595 19:771537-771559 CAGAGGAGGGAGAGGAGAGAGGG - Intergenic
1160765909 19:807824-807846 CAGCGGAGGGACAGGGGAGAGGG - Intronic
1160872075 19:1282205-1282227 TGGGGGAAGGAGGGGGGAGGAGG + Intergenic
1160975531 19:1790543-1790565 CAGTGGAGGGAGAAGGGGAGAGG - Intronic
1161093852 19:2377506-2377528 GAAGGGAAGGTGAGGGGAGGGGG - Intergenic
1161139333 19:2638435-2638457 AAGGGGAGGGGGAGGGGAGGGGG + Intronic
1161139350 19:2638468-2638490 GAGGGGAAGGGGAGGGGAAGGGG + Intronic
1161374667 19:3933350-3933372 GAAGGGGAGGAGAGGGGAGGAGG + Intronic
1161438776 19:4279211-4279233 CAGGGGGAGGGGAGGGGCGGGGG + Exonic
1161449807 19:4338771-4338793 CACTGGAAGGAGAGGCCAGGCGG - Exonic
1161575385 19:5051889-5051911 CAGAGGCAGGAGAGGGTGGGCGG - Intronic
1161821587 19:6533667-6533689 CTCTGGAGGGAGAGGGAAGGGGG - Intronic
1162012055 19:7823435-7823457 GAAAGGAAGGGGAGGGGAGGGGG + Intergenic
1162038184 19:7953584-7953606 GAGAGGAAGGAGAGGGGAGGGGG - Intergenic
1162089542 19:8269966-8269988 CAGGTGAAGGAAAAGGGAGGGGG + Intronic
1162129193 19:8515020-8515042 GAGTGCAAGGGGAGGCGAGGTGG - Intergenic
1162405053 19:10468393-10468415 AAGGGGATGGAGAGTGGAGGAGG - Exonic
1162534766 19:11256325-11256347 CAGAGGAGGGAGAGGGGAGGAGG + Intronic
1162594022 19:11613156-11613178 AAAGGAAAGGAGAGGGGAGGGGG - Intronic
1162785483 19:13032123-13032145 CAGTGGAGGGGGAGGGGGGCAGG + Intronic
1162843534 19:13373600-13373622 TTGGAGAAGGAGAGGGGAGGTGG - Intronic
1163004575 19:14389283-14389305 GAGGGGAAGGGGAGGGGAAGGGG + Intronic
1163106525 19:15125860-15125882 CAATGAAAGGCAAGGGGAGGCGG - Intergenic
1163171235 19:15532698-15532720 GAGGGGGAGGAGAAGGGAGGAGG - Intronic
1163199020 19:15749216-15749238 CAGGAGGAGGAGAGGAGAGGTGG - Intergenic
1163235671 19:16029111-16029133 AAGGGGAAGGGGAGGGGAGGGGG + Intergenic
1163347948 19:16756361-16756383 AAGAGGAGGAAGAGGGGAGGAGG + Intronic
1163498484 19:17661363-17661385 CAGTTGAAGGAGAGAGAAGGAGG + Intronic
1163627856 19:18401132-18401154 CAGTGAGAGGTGGGGGGAGGGGG - Intergenic
1163670153 19:18622874-18622896 CACTGGCAGGAGATGAGAGGAGG + Intergenic
1164250068 19:23468367-23468389 GAGAGGAGGGAGAAGGGAGGAGG - Intergenic
1164537561 19:29097574-29097596 CCTGGGAAGGAGAGGGGAGTGGG - Intergenic
1164562249 19:29300305-29300327 CAGTGTAAGCAGAGGGGTGGAGG - Intergenic
1164578459 19:29419558-29419580 GAGTGGAAGCAGAAGGGTGGGGG - Intergenic
1164592640 19:29514609-29514631 AGGAGGAAGGAGAGGGGATGAGG + Intergenic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1165305046 19:34998688-34998710 CAGAGGAAGGTGGTGGGAGGAGG + Intronic
1165736625 19:38180989-38181011 CTTTGGAAGGAGAGGAGAGAAGG - Intronic
1165768996 19:38367612-38367634 GAGTGGAAGGAGATGGGTGCAGG + Intronic
1165787270 19:38469235-38469257 CAGAGGGAGCCGAGGGGAGGAGG - Intronic
1165840936 19:38788953-38788975 CAGTGGGAAGACAGGGGTGGAGG + Intergenic
1165944403 19:39433058-39433080 GAGTGGAAGCAGAAGGCAGGGGG - Intergenic
1166139740 19:40799489-40799511 GAGTGGAGGGGGAGGGGAGGGGG + Intronic
1166161777 19:40959448-40959470 GAGGGGAAGGAGAGGGAGGGAGG - Intergenic
1166257170 19:41614939-41614961 GAGGGGAAGGGGAGGGGAAGGGG + Intronic
1166377231 19:42334342-42334364 CTCTGGAAGGAGAGGGAAGTGGG - Intronic
1166773713 19:45299883-45299905 CTGAGGCAGGAGAGGGGAAGTGG - Intronic
1166888111 19:45973575-45973597 GAGGGGGAGGGGAGGGGAGGTGG + Intergenic
1166888132 19:45973611-45973633 CGGTGGAGGGATGGGGGAGGGGG + Intergenic
1166985681 19:46659175-46659197 CGGTGGCAGGCGGGGGGAGGAGG - Intronic
1166994475 19:46713788-46713810 CTGGGGGAGGAGAGGGTAGGGGG - Intronic
1167072160 19:47227689-47227711 CGGAGGAAGGAGAGGGGGAGGGG - Intronic
1167152790 19:47719414-47719436 CTGTGCAAGGAGAGTGGCGGGGG + Intronic
1167225709 19:48238132-48238154 CACTGGGAGGCGAGGGCAGGTGG - Intronic
1167307352 19:48716744-48716766 CTGTGGAGGGAGGAGGGAGGTGG + Intronic
1167312912 19:48747367-48747389 CAGTGGGAGGAGAGGACTGGGGG + Intergenic
1167445905 19:49537374-49537396 CAGGGGACTGAGAGTGGAGGTGG - Intronic
1167464913 19:49645599-49645621 CAGTGCTGGGAGAGGGCAGGAGG + Intronic
1167575657 19:50316288-50316310 CTGGGGAGGGGGAGGGGAGGAGG + Intronic
1167619114 19:50551433-50551455 GGGTGGAAGGAGACCGGAGGAGG - Intronic
1167621631 19:50564012-50564034 CAAGGGAAGGAGAGTGGAGAGGG + Intronic
1167706935 19:51086674-51086696 CAGTGTGTGGAGAGGGTAGGAGG + Intergenic
1168389430 19:55993609-55993631 GAGAGGAGGGAGAGGGGAGAGGG - Intergenic
1168390090 19:56000010-56000032 CATTGAAAAGAGTGGGGAGGTGG - Intronic
1168547909 19:57269075-57269097 CAATGTAGTGAGAGGGGAGGTGG - Intergenic
1168696409 19:58406332-58406354 CCGTGGAAAGAGCGGGGGGGGGG + Intronic
1168706952 19:58475833-58475855 TATTGGCAGGTGAGGGGAGGGGG - Intronic
1202683867 1_KI270712v1_random:31364-31386 CAGTGGCAGAGGGGGGGAGGGGG - Intergenic
924998555 2:385934-385956 CTGTGGGAGGAAAGGGGAGCAGG - Intergenic
925186484 2:1850136-1850158 AAGGGGAAGGAAAGGGAAGGAGG - Intronic
925238557 2:2300689-2300711 GTGTGGGAGGAGAGGGGAAGTGG + Intronic
925380589 2:3422742-3422764 CAATGGATGGAGAGGTGATGGGG - Intronic
925418389 2:3690296-3690318 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
925418420 2:3690343-3690365 GAGGGGGAGGGGAGGGGAGGGGG - Intronic
925418458 2:3690403-3690425 AAGGGGGAGGGGAGGGGAGGGGG - Intronic
925423067 2:3727179-3727201 CAGGGGGAGGGGAGGGGAGGAGG - Intronic
925654944 2:6136658-6136680 AAGTGGAAGGAGAGGAGAAAGGG - Intergenic
926025329 2:9537928-9537950 GAGGGGGAGGAGAGGGGAAGGGG + Intronic
926143727 2:10384307-10384329 TTGTGGGAGGAGAGGGGTGGAGG + Intronic
926162597 2:10499383-10499405 CAGTGGATGGAACGGGTAGGAGG + Intergenic
926330567 2:11822013-11822035 CTGGGGAATGAGAGGGGAGTGGG - Intronic
926389229 2:12370496-12370518 CTGTGGGAGGAGAGAAGAGGAGG - Intergenic
926452626 2:13024126-13024148 CAATGGAAAGAGAGGGAGGGAGG + Intergenic
927279174 2:21288534-21288556 GAGTGGGAGGGGAGGGGAGGGGG + Intergenic
927338293 2:21950993-21951015 CAGAGGAAGGGGAGGGGGGGTGG - Intergenic
927636883 2:24823029-24823051 CTGGGGAAGGGGAGGTGAGGTGG - Intronic
927835747 2:26397396-26397418 AGGAGGAAAGAGAGGGGAGGAGG - Intergenic
927869937 2:26616942-26616964 GATTGGAAGGTGAGGGGAGCAGG + Intronic
928085406 2:28343320-28343342 CAAAGAAAGGAGAGGGGAAGGGG - Intergenic
928108456 2:28488196-28488218 GAGGGGAGGGGGAGGGGAGGGGG + Intronic
928115499 2:28542930-28542952 CAGTGGAAGGAGGGGGTGGCAGG - Intronic
928178787 2:29053190-29053212 CTGGGGAAGGGCAGGGGAGGGGG - Exonic
928255811 2:29721343-29721365 TAGTGGGAGAAGAGGGGTGGAGG + Intronic
928407990 2:31029606-31029628 AAGGGGAAAGAGAGGGGCGGAGG - Intronic
928680790 2:33700273-33700295 CAGTGGGAGGAGGGTGCAGGTGG - Intergenic
928948070 2:36789934-36789956 CAGTGGTAACAGAGGGGAGAAGG - Intronic
928979838 2:37126466-37126488 AAGGGAAAGGAGTGGGGAGGCGG - Intronic
929444461 2:41991844-41991866 GAGGGGAAGGAGGGAGGAGGAGG + Intergenic
929558682 2:42942188-42942210 AAGGGGAGGGAGAGGGGAAGGGG - Intergenic
929581718 2:43085618-43085640 CAGTGGACAGAGATGGGAGCAGG - Intergenic
930054305 2:47240203-47240225 CTGTGGAATGAGAGGGGCTGGGG + Intergenic
930639564 2:53840665-53840687 GAGGGGAGGGGGAGGGGAGGGGG + Intergenic
930673573 2:54176942-54176964 CTGTGAAAGGAGAGGGAAGCTGG - Intronic
930701144 2:54457894-54457916 CAGTGCAGGCAGAGGGGAGCCGG + Intronic
930826327 2:55700298-55700320 GAGGGGAGGGGGAGGGGAGGGGG - Intergenic
930946144 2:57078371-57078393 CTGTGTAAGGAGAGGGGGGCGGG - Intergenic
930975546 2:57455167-57455189 AAATGGAAGGAGAGAGGAGCAGG - Intergenic
931156315 2:59634787-59634809 CAATAGGAGGAGAGGGGAAGGGG - Intergenic
931496155 2:62809353-62809375 CAGTTGGGGGAGAGGGGAGGAGG - Intronic
931790260 2:65658362-65658384 CAGAGGAAGGTGGGGGGTGGAGG + Intergenic
932003632 2:67906801-67906823 CAGGGGAAGAAGATGGGATGGGG + Intergenic
932344554 2:70987055-70987077 CACTGGCAGTAGAGTGGAGGGGG + Exonic
932411728 2:71551557-71551579 CAGGGGAGACAGAGGGGAGGAGG - Intronic
932412265 2:71554520-71554542 CAGTGCAAGGAGATGGGGGGTGG + Intronic
932583074 2:73005133-73005155 AAGTGGAAGGAGAGGGAAACAGG + Intronic
932734071 2:74242117-74242139 AACTGGAAGGAGATGGGAAGGGG - Intronic
932742737 2:74304337-74304359 CAATGGAAGCAGAGCAGAGGGGG + Intronic
932770187 2:74496846-74496868 CAGTGTGAGGGGAGAGGAGGGGG - Intergenic
933765629 2:85706743-85706765 GAGTGGCAGGAGAGGGCAAGAGG - Intergenic
933912702 2:86957310-86957332 CAGTGGGAGGAGAGGGGATGTGG + Intronic
933990251 2:87628679-87628701 CTGTGGACAGTGAGGGGAGGAGG + Intergenic
934010293 2:87812580-87812602 CAGTGGGAGGAGAGGGGATGTGG - Intronic
934039030 2:88112365-88112387 CAGTGGTCTGAGAGGGAAGGAGG - Exonic
934049197 2:88196185-88196207 CAGGGGCAGGAGCGGGGAGGAGG - Intergenic
934117976 2:88813791-88813813 CAAGGGAAGGAGAGGAGAGCTGG + Intergenic
934187557 2:89760572-89760594 CACTGGTAGGGGAGGGGTGGGGG - Intergenic
934475306 2:94589504-94589526 CAGAGCAAGGAGAGGGGAATTGG - Intronic
934506090 2:94895736-94895758 CATAGGAGTGAGAGGGGAGGAGG + Intergenic
934756527 2:96828279-96828301 AGGTGGAAGGAGAGGTGAGGAGG - Intronic
935196576 2:100820017-100820039 CGGAGGCAGGCGAGGGGAGGAGG + Intergenic
935635830 2:105248979-105249001 CTGTGGAAGAAGATGGGAGCTGG + Intergenic
935725211 2:106018122-106018144 CAGGGCAAGGAGTGGGGAGTGGG + Intergenic
935773857 2:106453300-106453322 CAGTGGGAGGAGAGGGGATGCGG - Intronic
935787719 2:106563908-106563930 AAGAGGAAGGAGAGGCAAGGTGG + Intergenic
935906206 2:107842613-107842635 CAGTGGGAGGAGAGGGGATGCGG + Intronic
935918533 2:107985431-107985453 CAGTGTAAGAAAAGGGGAGATGG + Intergenic
935992674 2:108735136-108735158 CAGTGGGAGGAGAGGGGATGCGG + Intronic
935996747 2:108782212-108782234 CAGTGGAAGGAGCGCGGTGTTGG + Exonic
936254394 2:110899172-110899194 CTGTGGATTGAGAGGGGAAGTGG + Intronic
936303595 2:111322145-111322167 CTGTGGACAGTGAGGGGAGGAGG - Intergenic
936395563 2:112125636-112125658 AAGAGGAAGGAGGGAGGAGGAGG + Intergenic
936613103 2:114020670-114020692 CAGTGGAATGTGAGTGGAGGAGG + Intergenic
936745440 2:115570953-115570975 CACAGGACGGAGAGGGGAGTCGG + Intronic
936865007 2:117067283-117067305 AAGAGGAAGGAGTGGGGAAGAGG + Intergenic
937034528 2:118769815-118769837 GAAAGGAAGGAGAGGGAAGGAGG + Intergenic
937080726 2:119137773-119137795 CAGTGGCCAGAGAGGGCAGGTGG + Intergenic
937126313 2:119476983-119477005 CAGGGGTAGGGGAGGGAAGGTGG + Intronic
937197228 2:120169615-120169637 CGGAGGAAGGAGAAGGGAAGGGG - Intronic
937226747 2:120374724-120374746 CCTGGGAAGGGGAGGGGAGGAGG + Intergenic
937279469 2:120707447-120707469 CAGAGGCAGGAGAGGTGAGTGGG + Intergenic
937345216 2:121121163-121121185 CTGTGGAAGGGGAGGGCAGGGGG + Intergenic
937683903 2:124674423-124674445 GAAAGGAAGGAGAGGAGAGGAGG - Intronic
937825588 2:126365389-126365411 CGGGGGAAGGTGAGGGGATGGGG + Intergenic
937905875 2:127052519-127052541 CAGTGGTAGGAGAGAGGATGTGG - Intronic
938109604 2:128554978-128555000 TGGGGGAAGGAGAGGGGTGGAGG + Intergenic
938236610 2:129710987-129711009 CTCTGGATGGAGAGGAGAGGAGG - Intergenic
938375902 2:130806464-130806486 CAGAGGAAGCAGAGGGGTGCCGG + Intergenic
938502369 2:131836756-131836778 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
938594424 2:132772924-132772946 CAGTGAAAGGAGAGGAGAAATGG + Intronic
938628462 2:133138020-133138042 AAGTGGAGGGAAAGGGGAAGGGG + Intronic
938692880 2:133808399-133808421 CAATGGAAGAAGAGGTGATGCGG - Intergenic
938744014 2:134260011-134260033 CAGTGGAAAGAGAGAGGTGGAGG + Intronic
938775852 2:134540536-134540558 AGGAGGAAGGAGAGGGAAGGTGG + Intronic
939294166 2:140237170-140237192 TAGAGGGTGGAGAGGGGAGGAGG - Intronic
939419791 2:141951989-141952011 GGGTGGGGGGAGAGGGGAGGGGG - Intronic
939766153 2:146252204-146252226 GAGGGGAAGGAAAGGGGAAGGGG + Intergenic
939799966 2:146696846-146696868 GAGGGGAAGGGGAGGGGAAGGGG + Intergenic
939799972 2:146696857-146696879 GAGGGGAAGGGGAGGGGAAGGGG + Intergenic
939799978 2:146696868-146696890 GAGGGGAAGGGGAGGGGAAGGGG + Intergenic
939799984 2:146696879-146696901 GAGGGGAAGGGGAGGGGAAGGGG + Intergenic
939799990 2:146696890-146696912 GAGGGGAAGGGGAGGGGAAGGGG + Intergenic
939800000 2:146696912-146696934 GAGGGGAAGGAGAGGGGAAGGGG + Intergenic
940219383 2:151335847-151335869 CAGGGAAAGGAGAAGGGCGGTGG - Intergenic
940369155 2:152880886-152880908 TGGTGGAAGGAAAGGGGAGCAGG + Intergenic
940855398 2:158725190-158725212 CATTGGAGGGAGTGGTGAGGTGG - Intergenic
940946407 2:159623083-159623105 GAGGGGAGGGAGAGGGGAGAGGG + Intergenic
941038267 2:160590680-160590702 GAGGGGAAGGGGAAGGGAGGAGG - Intergenic
941038276 2:160590699-160590721 GAGGGGAAGGGGAAGGGAGGAGG - Intergenic
941038285 2:160590718-160590740 GAGGGGAAGGGGAAGGGAGGAGG - Intergenic
941204902 2:162559802-162559824 CACTGGAAAGAGAGAGGAGGTGG + Intronic
941272561 2:163448692-163448714 CAAGGGGAGGGGAGGGGAGGGGG + Intergenic
941809207 2:169738935-169738957 GAGGGGGAGGAGAGGGAAGGAGG - Intronic
942448219 2:176092505-176092527 AAGGGGCAGGAGAGGGGTGGGGG + Intergenic
942940119 2:181606411-181606433 GAGAGGAGGGGGAGGGGAGGGGG + Intronic
942940176 2:181606530-181606552 GAGAGGAGGGGGAGGGGAGGGGG + Intronic
943121655 2:183742995-183743017 GGGTGGGAGGAGGGGGGAGGGGG + Intergenic
943126360 2:183797390-183797412 CGGTGGGGGGAGTGGGGAGGGGG + Intergenic
944122655 2:196257267-196257289 CATTGGAGGGTGAGGGGCGGGGG + Intronic
944154845 2:196598178-196598200 GAGGGGAAAGAGAGGGGAAGGGG + Intergenic
944154867 2:196598221-196598243 GAGGGGAAGGGGAGGGGAAGGGG + Intergenic
944154907 2:196598302-196598324 GAGGGGAAGGGGAGGGGAAGGGG + Intergenic
944154937 2:196598364-196598386 GAAGGGAAGGGGAGGGGAGGAGG + Intergenic
944154948 2:196598383-196598405 GAGGGGAAGGGGAGGGGAAGGGG + Intergenic
944154962 2:196598413-196598435 GAAAGGAAGGGGAGGGGAGGAGG + Intergenic
944154973 2:196598432-196598454 GAGGGGAAGGGGAGGGGAAGGGG + Intergenic
944155009 2:196598515-196598537 GAGGGGATGGAGAGAGGAGGGGG + Intergenic
944326034 2:198404791-198404813 AAGGGGAAGAAGAGAGGAGGAGG - Intronic
944342389 2:198617372-198617394 CAGTGGGTGGAGATGGGAGGAGG + Intergenic
944505051 2:200402474-200402496 CAGGGGAATGGGAGGGAAGGTGG - Intronic
944718911 2:202403439-202403461 CTTTGGAAGGAGAAGGCAGGAGG - Intronic
944782985 2:203039341-203039363 AAGGAGAAGGGGAGGGGAGGGGG - Intronic
945125727 2:206507457-206507479 CAGTGGAAGGTGAAGGTGGGAGG - Intronic
945297114 2:208181732-208181754 CAGTGGCAGCGCAGGGGAGGTGG - Intronic
945754750 2:213832237-213832259 CTTTGGGAGGACAGGGGAGGTGG - Intronic
946010506 2:216560177-216560199 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
946010513 2:216560188-216560210 CAGAGGGAGGAGAGGGGAGGGGG - Intronic
946015881 2:216603349-216603371 GAGAGGAAGGGGAGGGGAGGAGG + Intergenic
946021923 2:216646226-216646248 CAGTGGAAGGGGAGGGTGGTGGG + Intronic
946040742 2:216781167-216781189 GAGAGGGAGGGGAGGGGAGGGGG - Intergenic
946130708 2:217604509-217604531 CATTGGGAGGAGAGGGGGGCAGG + Intronic
946387956 2:219397200-219397222 GGGTGGGAGGGGAGGGGAGGGGG - Intronic
946399375 2:219460669-219460691 GAGGGGGAGGAGAGGGGAGAGGG - Intronic
946408741 2:219506218-219506240 CAGTGAAAGGTAAGGGGAAGAGG - Intronic
946418047 2:219550402-219550424 CAGTGGCAGGAGATGGGGGTGGG + Exonic
946486284 2:220103615-220103637 AAGTGGAGGGTGAGAGGAGGTGG - Intergenic
946620278 2:221554567-221554589 CACTGGGGGGAGTGGGGAGGAGG + Intronic
946921494 2:224585410-224585432 CAGAGGGTGGAGGGGGGAGGAGG + Intergenic
947077016 2:226355732-226355754 AAGAGGAAGGAGAGGAAAGGAGG + Intergenic
947141956 2:227027479-227027501 GAGTGGGAGGAGGGGGGAGGGGG + Intronic
947506959 2:230714291-230714313 TTGTGAAAGGAGAGAGGAGGAGG + Intronic
947732186 2:232437406-232437428 GTGTGGAAGGGGAGGGGAGCTGG + Intergenic
948034487 2:234847154-234847176 CAGGGGATGGAGAGAGGAGAAGG + Intergenic
948120723 2:235528360-235528382 CAGTGGGAGGGGAGGGGGCGGGG - Intronic
948285154 2:236778523-236778545 TAGGGGAGGGAGAGGGGAGTAGG - Intergenic
948307146 2:236956769-236956791 CTGTGAAAGGAAAAGGGAGGAGG - Intergenic
948327709 2:237139927-237139949 CACAGGAAGGAATGGGGAGGGGG - Intergenic
948405341 2:237713140-237713162 GCGTGTACGGAGAGGGGAGGTGG + Intronic
948765472 2:240216854-240216876 GAGTGGAAGGATGGGGGTGGGGG + Intergenic
948804293 2:240446837-240446859 CAGAGGACGGAGAGGGGACCAGG + Intronic
948846345 2:240684484-240684506 CAGTGGACGGGTTGGGGAGGGGG - Intergenic
948847517 2:240690249-240690271 CAGTGGATGGGTTGGGGAGGGGG + Intergenic
1168987169 20:2059460-2059482 CAGTGGAAGGAAATCAGAGGGGG + Intergenic
1169085492 20:2823076-2823098 CCGTGGAGGGAGACGGGAGAGGG - Intergenic
1169285478 20:4304026-4304048 CCCTGTAAGGAGTGGGGAGGTGG + Intergenic
1169355502 20:4901620-4901642 CAGTGGGAGGGGAGGGCAGCCGG - Intronic
1169456683 20:5758348-5758370 GAGGGGAAGGAGAGGGGGAGGGG + Intronic
1169612711 20:7400521-7400543 CAGTGGATGGAGTGGAGTGGAGG + Intergenic
1169819509 20:9693384-9693406 GAATGGAAGCAGAAGGGAGGAGG - Intronic
1169867602 20:10218083-10218105 CGGGGGAAGGAGAAGGGAAGCGG - Intergenic
1170004402 20:11649275-11649297 AAGTGGAAGGAGAGAGGTAGGGG - Intergenic
1170032708 20:11959360-11959382 GAGGGGAAGGAGGGTGGAGGAGG + Intergenic
1170037693 20:12006008-12006030 GAGAGGAAGGAGAGGGGTTGGGG - Intergenic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170405648 20:16032866-16032888 AAGAGGAAGGACAGGAGAGGAGG + Intronic
1170480109 20:16756847-16756869 AAGAGAGAGGAGAGGGGAGGAGG + Intronic
1170497541 20:16940812-16940834 CAGTGGGAGAAGAGGAGACGTGG - Intergenic
1170762548 20:19263618-19263640 CAGGGAAAGGAGAGAGGATGTGG - Intronic
1170773229 20:19352122-19352144 CGGTGGGAGGGGCGGGGAGGGGG + Intronic
1171066208 20:22017972-22017994 CAGAGGGAGGAGAGGGGATATGG + Intergenic
1171249697 20:23638242-23638264 GAGGGGAGGGAGAGGGGAGGCGG - Intronic
1171557605 20:26092364-26092386 CAGAGGAGGCAGAGGGCAGGAGG + Intergenic
1171893623 20:30740772-30740794 CATAGGAATGAGAGGGGAGGAGG + Intergenic
1172134779 20:32679643-32679665 CAGTGGGAGCTAAGGGGAGGAGG - Intergenic
1172608203 20:36230002-36230024 GAGTTGAGGGTGAGGGGAGGCGG - Exonic
1172723457 20:37016924-37016946 CAGGGGAGGGGGAGAGGAGGGGG + Intronic
1172806034 20:37612528-37612550 GAATGGAAGCAGAGAGGAGGTGG - Intergenic
1172913839 20:38429441-38429463 ACGTGGAAGGAGAGGTGTGGAGG + Intergenic
1172974032 20:38893574-38893596 AAGTGGGAGGAGGCGGGAGGAGG + Intronic
1173002026 20:39111587-39111609 GGGAGGAAGGAGGGGGGAGGAGG + Intergenic
1173347994 20:42218583-42218605 CAGTGCAAGGAGAGGGGCCTGGG - Intronic
1173438835 20:43057278-43057300 GGGGGGAAGGGGAGGGGAGGGGG + Intronic
1173553672 20:43950483-43950505 CAGAGCAAGCAGTGGGGAGGGGG - Intronic
1173564926 20:44031795-44031817 AAGTGGAGGGTGAAGGGAGGGGG + Intronic
1173628963 20:44495661-44495683 CTGTGTAAGGAGGGGGCAGGGGG - Intergenic
1174035847 20:47667830-47667852 CAGTGGAAGGAGGGAGGAAAGGG + Intronic
1174462388 20:50691854-50691876 AAGAGGAAGGAGAGGGCTGGAGG - Intergenic
1174503562 20:51002762-51002784 CAGTGCCAGGCGTGGGGAGGGGG - Intergenic
1175541661 20:59751677-59751699 CACAGGAACGAGAGGGGAGGGGG - Intronic
1175573874 20:60045730-60045752 CAGAGGCAGGGGAGGGTAGGAGG + Intergenic
1175609957 20:60342584-60342606 CAGAGGATGGAGAGGAGAGAGGG - Intergenic
1175690024 20:61058322-61058344 CTTTGGAAGGAGAGGTGATGAGG + Intergenic
1175743333 20:61435956-61435978 CTGGAGAAGGCGAGGGGAGGTGG - Intronic
1175903047 20:62367426-62367448 GGGGGGAAGGAGAGAGGAGGGGG + Intergenic
1175979971 20:62733765-62733787 CAGAGGAGAGAGAGGGGAGGAGG + Intronic
1176037135 20:63045107-63045129 CTGAGGTGGGAGAGGGGAGGAGG - Intergenic
1176048195 20:63103310-63103332 GGGAGGAAGGAGTGGGGAGGAGG + Intergenic
1176048224 20:63103383-63103405 GGGAGGAAGGAGTGGGGAGGAGG + Intergenic
1176051638 20:63122857-63122879 TTGTGGAAGGAGATGGGACGAGG + Intergenic
1176118926 20:63445504-63445526 CAGAGGCTGGAGAGGGGTGGGGG - Intronic
1176125468 20:63472838-63472860 GAGGGGAGGGAGAGGGGACGGGG + Intergenic
1176125522 20:63472965-63472987 GAGTGGAGGGGGAGGGGAGGGGG + Intergenic
1176198255 20:63847856-63847878 CTGGGGGAGGAGAGGGGAAGTGG - Intergenic
1176244973 20:64093132-64093154 CACAGGGAGGGGAGGGGAGGGGG + Intronic
1176620139 21:9050598-9050620 CATAGGAGTGAGAGGGGAGGAGG - Intergenic
1178028467 21:28495832-28495854 CTGAGGAAGCAGTGGGGAGGCGG - Intergenic
1178046472 21:28700148-28700170 TGGTGGGAGGAGAGGGGAAGGGG - Intergenic
1178267911 21:31161381-31161403 CAGTCACAGGAGAGAGGAGGCGG + Intronic
1178318645 21:31588158-31588180 GAGGGGAAGGGGAGGGGAAGAGG + Intergenic
1178322315 21:31614808-31614830 GAGGGGAAGGGGAGGGGAAGGGG + Intergenic
1178322321 21:31614819-31614841 GAGGGGAAGGGGAGGGGAAGGGG + Intergenic
1178322327 21:31614830-31614852 GAGGGGAAGGGGAGGGGAAGGGG + Intergenic
1178407250 21:32334988-32335010 CAGTGGATGGGGGAGGGAGGAGG - Intronic
1178430263 21:32512561-32512583 CACTGGGAGAGGAGGGGAGGGGG + Intronic
1178526043 21:33330291-33330313 CAGGGGAGTGAGTGGGGAGGGGG - Intronic
1178951981 21:36992800-36992822 CAGGGGAGGGGGAGTGGAGGTGG - Intergenic
1179030073 21:37712606-37712628 AAGAGGAGGGAGAGAGGAGGAGG - Intronic
1179135777 21:38678837-38678859 AAGGGGAGGGGGAGGGGAGGGGG + Intergenic
1179135784 21:38678848-38678870 GAGGGGAGGGGGAGGGGAGGGGG + Intergenic
1179135809 21:38678897-38678919 AATGGGGAGGAGAGGGGAGGGGG + Intergenic
1179135829 21:38678930-38678952 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
1179150601 21:38805731-38805753 AAGCGGGAGGAGAGGGAAGGGGG - Intronic
1179170704 21:38970733-38970755 CCGTGGGAAGAGAGGGCAGGTGG - Intergenic
1179568933 21:42266620-42266642 CAGAGGACAGAGATGGGAGGAGG - Intronic
1179572681 21:42287147-42287169 CAGAGGCAGGAGAGGGCAGAGGG + Intronic
1179626758 21:42653522-42653544 CGGGGGAGGGAGGGGGGAGGGGG + Intergenic
1179648507 21:42791173-42791195 CAGTGGGAGGCTAAGGGAGGAGG + Intergenic
1179653114 21:42827563-42827585 TAGTGGGAGGGTAGGGGAGGTGG - Intergenic
1179714303 21:43279882-43279904 CAGGTGGAGGGGAGGGGAGGTGG + Intergenic
1179714397 21:43280112-43280134 GAGGGGGAGGGGAGGGGAGGTGG + Intergenic
1179714496 21:43280332-43280354 AGGTGGAGGTAGAGGGGAGGTGG + Intergenic
1179714521 21:43280388-43280410 GAGGGGGAGGGGAGGGGAGGTGG + Intergenic
1179714598 21:43280566-43280588 GAGGGGGAGGGGAGGGGAGGTGG + Intergenic
1179714618 21:43280611-43280633 CAGTGGAGGTGGAGGGGACGGGG + Intergenic
1179714707 21:43280815-43280837 AGGTGGAGGTAGAGGGGAGGTGG + Intergenic
1179714713 21:43280832-43280854 AGGTGGAGGTAGAGGGGAGGTGG + Intergenic
1179714741 21:43280897-43280919 AGGTGGAGGTAGAGGGGAGGTGG + Intergenic
1179714754 21:43280923-43280945 TAGGGGGAGGGGAGGGGAGGTGG + Intergenic
1179724681 21:43335511-43335533 CTGGGGTAGGAGAGGGCAGGAGG + Intergenic
1179929397 21:44557510-44557532 CAGAGGAAGGAGAGAGGGGGAGG + Intronic
1180018573 21:45104143-45104165 AAGTGGAAGGAGAGGGTAGCAGG - Intronic
1180226785 21:46398242-46398264 CGCTGGATGGAGAGGTGAGGAGG + Exonic
1180556058 22:16576065-16576087 GAGGGGAATGTGAGGGGAGGGGG + Intergenic
1180684382 22:17653745-17653767 CTTTGGAAGGACAAGGGAGGAGG - Intronic
1180941764 22:19664112-19664134 AGGGGGCAGGAGAGGGGAGGAGG - Intergenic
1180988465 22:19919490-19919512 CTGGGGAAGGAGGTGGGAGGTGG - Intronic
1181051320 22:20239518-20239540 CAGTGGCAGGGGTGGGGAGTTGG - Intergenic
1181111662 22:20606144-20606166 CAGTGGCATGTGAGGAGAGGGGG + Intergenic
1181284024 22:21739344-21739366 CAGAGTTAGCAGAGGGGAGGAGG - Intergenic
1181471959 22:23145975-23145997 CAGTGGAAGTAGAGTGGGGAGGG - Intronic
1181509456 22:23382527-23382549 CAGTGCAGGGCCAGGGGAGGGGG - Intergenic
1181876801 22:25946018-25946040 AGGTGGGAGGGGAGGGGAGGTGG - Intronic
1181876810 22:25946035-25946057 AGGTGGGAGGGGAGGGGAGGTGG - Intronic
1181901551 22:26160323-26160345 GAGAGGAAGTAGAGGGAAGGAGG + Intergenic
1181977230 22:26738528-26738550 GAGGGGGAGGGGAGGGGAGGTGG - Intergenic
1181996083 22:26883842-26883864 CAGGGGCCAGAGAGGGGAGGCGG - Intergenic
1182048950 22:27298766-27298788 GAGATGAAGGAGAGGGGAAGAGG + Intergenic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1182349776 22:29692721-29692743 CACTGGAAGGAGAGGGGCCAGGG + Intronic
1182351908 22:29704266-29704288 AGGTGGGAGGGGAGGGGAGGGGG - Intergenic
1182394910 22:30028243-30028265 GAGTGGAAGGAGATGTGGGGTGG + Intronic
1182522875 22:30894030-30894052 CAGGCAAAGGAGAGGGAAGGAGG + Intronic
1182566643 22:31205096-31205118 CAGAGGAAGAAGAGGGGGAGTGG - Exonic
1182679836 22:32070229-32070251 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
1182679843 22:32070240-32070262 GAGGGGGAGGGGAGGGGAGGGGG - Intronic
1182681258 22:32081845-32081867 GCCTGGAAGGAGAGGAGAGGCGG - Exonic
1182696854 22:32204003-32204025 CGGTGGGAGGAGAGGGGCAGAGG - Intergenic
1182972854 22:34593866-34593888 AAGGGGGAGGGGAGGGGAGGGGG + Intergenic
1183060705 22:35334831-35334853 CAGTGCAGGGAGGGGGGCGGGGG - Intronic
1183108313 22:35630229-35630251 CAGAGGAGGGAGAGGAGAGGAGG + Intronic
1183402695 22:37613927-37613949 GGGTGGGAGGAGTGGGGAGGAGG + Intronic
1183495309 22:38139953-38139975 CAGCAGATGGGGAGGGGAGGAGG + Intronic
1183543615 22:38443915-38443937 CCGTGGTTGGAGAGTGGAGGGGG - Intronic
1183740797 22:39667389-39667411 CAGTGGCAGGAGCGCAGAGGGGG + Intronic
1183783066 22:40011080-40011102 CTGTGGAAGGAGAAAGGAGTGGG - Intronic
1184096356 22:42318412-42318434 CTGTGAGAGGAGAGGGGAGGAGG + Intronic
1184209073 22:43024610-43024632 CAGTGGAAGGAAAGGTGCTGGGG + Intergenic
1184412915 22:44336297-44336319 CAGTGGCAGGTGAAGGGCGGAGG - Intergenic
1184421437 22:44384868-44384890 GAGGGGCAGGAGAGGGGAGATGG + Intergenic
1184452165 22:44589720-44589742 CAGAAGGAGGAGAGAGGAGGAGG + Intergenic
1184468030 22:44680382-44680404 TAGTGGAAGGAAAGGGGGGATGG + Intronic
1184509013 22:44921212-44921234 CAGGGTAAGGAGAAGGGAGATGG + Intronic
1184593453 22:45500782-45500804 CAGTGAAAGGTGAGCAGAGGTGG - Intergenic
1184673100 22:46025974-46025996 TAGAGGCAGGAGAGGTGAGGAGG - Intergenic
1184861832 22:47176749-47176771 CTGTGGAAAGAGAGGTGAAGAGG - Intergenic
1184933710 22:47702223-47702245 GAGAGGAGGGGGAGGGGAGGGGG - Intergenic
1185041980 22:48508964-48508986 TAGAGGCTGGAGAGGGGAGGAGG - Intronic
1185197135 22:49478697-49478719 CAGGAGGAAGAGAGGGGAGGGGG + Intronic
949311874 3:2709057-2709079 CAGTGGCAGCAGAGGGGGGATGG - Intronic
949549863 3:5104052-5104074 AGGGGGAAGGAGGGGGGAGGAGG - Intergenic
949549895 3:5104138-5104160 CTGGGGGAGGAGGGGGGAGGAGG - Intergenic
949914176 3:8944593-8944615 GAGGGGAAGGAGAAAGGAGGAGG + Intronic
950119395 3:10471559-10471581 GAGTGGGAGGAGAGGGAGGGAGG + Intronic
950146697 3:10655247-10655269 GAGAGGGAGGAGAGTGGAGGGGG - Intronic
950285574 3:11742218-11742240 CAGTGGGAGGGGAGGGGAGTGGG - Intergenic
950422962 3:12909440-12909462 AAAGGGAAGGAGAGGGGAGGAGG + Intronic
950437954 3:12992043-12992065 CAGTGGAGGGACAAGGGAGGGGG - Intronic
950475765 3:13214025-13214047 CAGAGGAAGGAGCCGGGTGGCGG - Intergenic
950546040 3:13638636-13638658 CAGAGGAGGGAGGAGGGAGGAGG - Intergenic
950626382 3:14250406-14250428 GAGGGGGAGGAGAGAGGAGGAGG - Intergenic
950890522 3:16400305-16400327 CAGGGGAGGGAGGGTGGAGGTGG - Intronic
951174068 3:19578642-19578664 CAATGGAAGGAGGTGGGAAGTGG + Intergenic
951537303 3:23751582-23751604 CAGGGGAGGGAGATGGGAGGGGG - Intergenic
951688283 3:25369047-25369069 CAGTGGTGGGAGAGAGGAGTAGG + Intronic
951718062 3:25670178-25670200 CAATTGAGGGAGAGGGGAGATGG + Intergenic
951923895 3:27886422-27886444 CAGTGGAGAGAGAGGTGGGGAGG + Intergenic
952881431 3:37988315-37988337 CACTGGAAGGTTTGGGGAGGGGG + Intronic
953365438 3:42340491-42340513 AAGGGGGAGGAGGGGGGAGGAGG + Intergenic
953635567 3:44660918-44660940 AAGTGATGGGAGAGGGGAGGTGG + Intergenic
953739598 3:45525989-45526011 GAGGGGAAAGAGAGAGGAGGAGG + Intronic
953822672 3:46221948-46221970 CAGTGGCAAGAGAGGGGCTGGGG - Intronic
953824329 3:46236839-46236861 CAGAGGAGGGAAAGGGGAGTGGG + Intronic
953918394 3:46935346-46935368 AGGTGGGAGGAGAAGGGAGGAGG - Intronic
954138064 3:48591374-48591396 GTGTGGAAGGAGAGGGCTGGAGG + Intronic
954200928 3:49022636-49022658 CAGTGGATGGAGATGGGGAGAGG + Intronic
954346513 3:50004310-50004332 CAATAAGAGGAGAGGGGAGGGGG - Intronic
954397112 3:50298772-50298794 GTGTGGGAGGTGAGGGGAGGGGG - Intronic
954399795 3:50312961-50312983 CCGTGGAGGGAGAGGGGGAGGGG + Intergenic
954411797 3:50374204-50374226 GGGGGGAAGGTGAGGGGAGGGGG + Intronic
954411868 3:50374363-50374385 GAGGGGAAGGGGAGTGGAGGTGG + Intronic
954456601 3:50603057-50603079 AAGTGGAAGGCGAGGGGCCGGGG - Intergenic
954940906 3:54372313-54372335 CAGTGAAAGAAGAGGGTGGGTGG + Intronic
955333806 3:58068858-58068880 CATTAGAGGGAGAGGGGATGGGG + Intronic
955349293 3:58182173-58182195 GAGGGGGAGGGGAGGGGAGGAGG + Intergenic
955386799 3:58487086-58487108 GAGAGAGAGGAGAGGGGAGGAGG + Intergenic
955769497 3:62373622-62373644 CGGTGGAAGGAAAGGGGGGGGGG + Intronic
955779820 3:62472594-62472616 CTCTGGATGGAGAGGGGAGGAGG - Intronic
955796755 3:62645194-62645216 CAGGGGAAAGAGTGGGAAGGGGG + Intronic
955817506 3:62861043-62861065 CCATAGAAGGAGAGAGGAGGAGG - Intronic
955833647 3:63030433-63030455 AAGAGGAAGGGGAGGGGAGGGGG + Intergenic
955895091 3:63690682-63690704 CAGTGGAAGAAGTGGGGAATGGG - Intergenic
956068149 3:65418796-65418818 GAGAGGCTGGAGAGGGGAGGAGG - Intronic
956140238 3:66139035-66139057 AAGAGGATGGGGAGGGGAGGAGG - Intronic
956468781 3:69543281-69543303 GAGAGGAAGGAGAGGAAAGGAGG + Intergenic
956659684 3:71584563-71584585 CAGTTGAAGGAGAGCGGGGTGGG + Intergenic
956754085 3:72368374-72368396 CAGGGGGAAGAGAGGGAAGGTGG - Intergenic
957311556 3:78526151-78526173 CTGGGGAAGGAGAGGGGAGGAGG - Intergenic
957537729 3:81528219-81528241 GGGTGGGAGGAGGGGGGAGGGGG + Intronic
957568052 3:81909470-81909492 CAGTGGGAGGTGGGGGGTGGGGG - Intergenic
957719352 3:83973502-83973524 GGGTGGGAGGAGGGGGGAGGGGG + Intergenic
957843238 3:85698579-85698601 CAGGAGAAGGAGAGGTGGGGTGG + Intronic
957873908 3:86120392-86120414 GAGTGGAAGGGTAGGGGAGTTGG - Intergenic
958053712 3:88383071-88383093 TAGAGGGAAGAGAGGGGAGGAGG - Intergenic
958079150 3:88723000-88723022 GGGTGGGAGGAGGGGGGAGGGGG + Intergenic
958798163 3:98728612-98728634 GGCTGGAAGGTGAGGGGAGGTGG - Intergenic
959356273 3:105333341-105333363 TAGAGGATGGAGAGGGTAGGTGG + Intergenic
959695184 3:109241534-109241556 CAGGGGAAGAAGAAGGGTGGGGG + Intergenic
959921191 3:111870225-111870247 CATTGGAAGGAGAGAGGATCTGG + Intronic
960089812 3:113627838-113627860 CACAGGAAGGAGAGGGGCTGCGG + Exonic
960337652 3:116437597-116437619 GAGAGGAAGGAGAGAGGAGAAGG + Intronic
961075100 3:123975188-123975210 CAGTGGCAGGGGTTGGGAGGAGG - Intronic
961308595 3:125977334-125977356 CAGTGGCAGGGGTTGGGAGGAGG + Intronic
961362414 3:126376194-126376216 CAGAGGAAACAGAGTGGAGGCGG + Intergenic
961368162 3:126414450-126414472 CAGTGGAAGTGGCGGCGAGGTGG - Intronic
961481520 3:127183759-127183781 GAAAGGAAGGGGAGGGGAGGTGG - Intergenic
961524736 3:127489523-127489545 CAGTGGAAGCCCAGGGCAGGAGG + Intergenic
961535672 3:127569072-127569094 CACTGGAAGCTGAAGGGAGGTGG + Intergenic
961868990 3:129974831-129974853 CTGCGGAAGGAGAGGGGTTGGGG - Intronic
961940861 3:130636754-130636776 GAGGGGGAGGGGAGGGGAGGAGG - Intronic
961940876 3:130636782-130636804 GAGGGGGAGGGGAGGGGAGGAGG - Intronic
961940884 3:130636798-130636820 AAGGGGAGGGGGAGGGGAGGGGG - Intronic
961940898 3:130636821-130636843 AAGGGGAGGGGGAGGGGAGGAGG - Intronic
961940948 3:130636918-130636940 AGGGGGAAGGGGAGGGGAGGGGG - Intronic
961988058 3:131158406-131158428 CAATGGCAGGGGAGGTGAGGTGG - Intronic
962194149 3:133343999-133344021 CTGTGGATGGAGAGTGCAGGGGG - Intronic
962479432 3:135785782-135785804 CAGGGGACAGAGTGGGGAGGTGG + Intergenic
962480375 3:135792813-135792835 CAGTGGAAGATGAGGGAAGCTGG - Intergenic
962622326 3:137192144-137192166 GAGTGGGAGGAGTGAGGAGGTGG + Intergenic
962649890 3:137477822-137477844 CAGGGCAATGGGAGGGGAGGGGG + Intergenic
962797623 3:138862771-138862793 CAATGGAAGGAAAGAGGAAGTGG + Intergenic
963092474 3:141497167-141497189 GGGTGGGGGGAGAGGGGAGGGGG + Intronic
963115601 3:141726462-141726484 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
963498210 3:146095897-146095919 CTGTGGAGGGAGAGGGGGGAGGG - Intronic
963755546 3:149231769-149231791 GAGAGGGAGGAGAAGGGAGGAGG + Intergenic
963769871 3:149378852-149378874 CAGTGGATGGTGGTGGGAGGTGG + Intergenic
963861255 3:150313021-150313043 GAGAGGCAGGAAAGGGGAGGGGG - Intergenic
964002832 3:151796186-151796208 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
964108363 3:153063159-153063181 CAGCAGAGGGAGAGGGGAAGTGG - Intergenic
964373971 3:156031401-156031423 CAGTGGAAGGAGTGGGGTGGAGG + Intergenic
964639381 3:158892419-158892441 CACTGGAGGGATAGGGCAGGAGG - Intergenic
964644452 3:158943712-158943734 AGCTGGAAGGAGTGGGGAGGGGG + Intergenic
964786251 3:160399679-160399701 CACCGGTAGGAGCGGGGAGGTGG + Exonic
964871333 3:161316711-161316733 GAGTGGAAGGAAAGGAAAGGAGG - Intergenic
965410606 3:168326059-168326081 CAGAGGAAGCAGAGTGGAGTTGG + Intergenic
965520203 3:169662948-169662970 GGGGGGAAGGGGAGGGGAGGGGG + Intronic
966140540 3:176751970-176751992 GAAGGGAAGGGGAGGGGAGGAGG + Intergenic
966306122 3:178536819-178536841 AAGAGGAGGGAGAGGGGAGTGGG + Intronic
966369805 3:179238050-179238072 GAGGGGAATGTGAGGGGAGGGGG + Exonic
966616378 3:181917955-181917977 AATTAGAAAGAGAGGGGAGGAGG + Intergenic
966881771 3:184354690-184354712 CAGTGGAGGGGGAGGGCAGGGGG + Intronic
966954742 3:184864126-184864148 AAGGAGAAGGAGAAGGGAGGGGG + Intronic
967127697 3:186439899-186439921 CAGTGGGACAGGAGGGGAGGCGG - Intergenic
967553815 3:190831471-190831493 CAGTGGATGGGGAATGGAGGCGG - Intergenic
967685382 3:192410270-192410292 GAGAGGAGGGAGAGGGGTGGCGG - Intronic
967823779 3:193862435-193862457 GAGAGGAAGGAGAGGACAGGAGG - Intergenic
967892395 3:194372534-194372556 CCCTGGAAGGTGAGGGGAGAGGG + Intergenic
967898230 3:194417999-194418021 GGGAGGGAGGAGAGGGGAGGCGG + Intronic
967962822 3:194939406-194939428 CAGGGGAGGTAGAGGGGAGACGG + Intergenic
968066694 3:195762944-195762966 ACCTGGAAGGAGATGGGAGGGGG + Exonic
968155155 3:196374879-196374901 GAGGGGAGGGGGAGGGGAGGGGG + Intronic
968183215 3:196612581-196612603 CAGTGGAAGAACACTGGAGGAGG - Intergenic
968262607 3:197337280-197337302 GAAAGGAAGGAGAAGGGAGGAGG + Intergenic
968455066 4:693511-693533 CGCTGGACGGGGAGGGGAGGAGG - Intergenic
968529979 4:1086592-1086614 GGGTGGCAGGAGAGGGGTGGGGG + Intronic
968530017 4:1086688-1086710 GGGTGGAAGGACAGGGGTGGGGG + Intronic
968582424 4:1401311-1401333 CAGCGGAGGGAGGAGGGAGGAGG + Intergenic
968584131 4:1408093-1408115 GAGGGGAAGGGGAGGGGAAGAGG - Intergenic
968584135 4:1408104-1408126 GAGGGGAAGGGGAGGGGAAGGGG - Intergenic
968606582 4:1538342-1538364 CAGTGGTGGGAGGGGAGAGGTGG + Intergenic
968610002 4:1552589-1552611 CAGTGGGAGGTGAGGGGAGAGGG + Intergenic
968613455 4:1567265-1567287 CAGTGGAGGGAGAGAGGGAGGGG + Intergenic
968658572 4:1789378-1789400 GAGTGGAAGGACAGGGGACACGG - Intergenic
968684071 4:1944520-1944542 CTGTGCTTGGAGAGGGGAGGTGG + Intronic
968745286 4:2356722-2356744 GCGTGGAAGGAGAGGAGGGGAGG + Intronic
968758296 4:2427947-2427969 CAGGGGCTGGAGAGGGGAGCAGG + Intronic
968952006 4:3700217-3700239 GAGTGGAGGGGGAGGGGGGGAGG + Intergenic
969134566 4:5019749-5019771 CAGCAGATGGAGAGGGGTGGGGG + Intergenic
969160052 4:5248927-5248949 GGGTGGGGGGAGAGGGGAGGAGG + Intronic
969173763 4:5384132-5384154 GAGTGGAAGGAGGATGGAGGGGG + Intronic
969270300 4:6095064-6095086 AAGTGGAAGGAAGGGGGAGTGGG + Intronic
969370351 4:6727714-6727736 GGGAGGAAGGGGAGGGGAGGGGG - Intergenic
969370429 4:6727866-6727888 GAGGGGGAGGGGAGGGGAGGGGG - Intergenic
969437456 4:7196631-7196653 GAGGGGAGGGAGAGGGAAGGGGG - Intronic
969707442 4:8819594-8819616 CAGGGGAAGGGGAAGGGAGTAGG + Intergenic
969724346 4:8910506-8910528 CAGTGGCAGGGGTGGGGGGGCGG + Intergenic
970005878 4:11410306-11410328 CAGAGGAAAGAGATGGGAGCTGG + Intronic
970074185 4:12198797-12198819 GAGAGGAGGGAGAGAGGAGGAGG + Intergenic
970603936 4:17661811-17661833 GAGTCCCAGGAGAGGGGAGGGGG + Intronic
970689621 4:18607514-18607536 CACTGGAATCAGAGGGGAAGTGG - Intergenic
971164832 4:24172294-24172316 CAGGGGATGGAGTGGGGTGGAGG - Intergenic
971296876 4:25401603-25401625 CAGTGCACGGAGAGGGCAGCTGG - Intronic
971400375 4:26270293-26270315 GAAGGGAAGGGGAGGGGAGGAGG + Intronic
971466408 4:26967816-26967838 CTGTTGGAGGAGGGGGGAGGGGG - Intronic
972053148 4:34765404-34765426 AAGTGGAGGGAAAGGGGAAGTGG + Intergenic
972231906 4:37082482-37082504 GAGTGAAAGGCAAGGGGAGGGGG + Intergenic
972756278 4:42050359-42050381 CAGTGGGAGGAGAGGGGATAGGG + Intronic
972933607 4:44104624-44104646 CAGTGGAAGGAGAGTGTGGGTGG + Intergenic
973334802 4:48945051-48945073 CAGTGGCAGGAAATGGGAGGTGG + Intergenic
973772254 4:54217716-54217738 CAGTGCTGGGGGAGGGGAGGAGG - Intronic
973779138 4:54271969-54271991 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
973779159 4:54272000-54272022 GAAGGGAAGGGGAGGGGAGGGGG - Intronic
974693715 4:65337364-65337386 AAGAGGAAGGGGAAGGGAGGAGG - Intronic
974752311 4:66156588-66156610 CAGTGGAAGGGGAGCTGAGAAGG - Intergenic
974833397 4:67216430-67216452 GAGGGGAGGGGGAGGGGAGGGGG + Intergenic
974849264 4:67385605-67385627 AAGGGGAGGGGGAGGGGAGGGGG + Intergenic
975172240 4:71245567-71245589 CAGTGGAGGAAGAGTGGTGGGGG + Intronic
975267663 4:72390008-72390030 CAGGAAAAGGAGAGGGGAAGCGG + Intronic
975541229 4:75514292-75514314 CGGTGGAATGTGAGGGGAGGTGG - Exonic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
976130225 4:81876326-81876348 GAGGGGAAGGGGAGGGGAGTGGG - Intronic
976200193 4:82570370-82570392 GACTGGAAGTAAAGGGGAGGTGG - Intergenic
976225054 4:82789323-82789345 GAGGGGAAGCAAAGGGGAGGAGG + Intronic
977179503 4:93856913-93856935 CATTGGGAGGAGAAGGTAGGTGG + Intergenic
977682134 4:99808490-99808512 CTGTGGAAGTGGAGGGGAAGAGG + Intergenic
977891707 4:102319619-102319641 CAGGGGTAGGAGTGGGGAGGGGG - Intronic
978005409 4:103609747-103609769 GAGTGGCAGGAGAGGGGATGGGG - Intronic
978490186 4:109303338-109303360 CAGTGGGAAGAGAAGGGAAGTGG - Intergenic
979558515 4:122077302-122077324 CAGAGGAAGAAGAGGGGGAGTGG + Intergenic
980191190 4:129527449-129527471 CAGAGGAAGGAGGATGGAGGTGG + Intergenic
980707572 4:136519785-136519807 CAGTGAAAGCAGCTGGGAGGGGG - Intergenic
980873636 4:138638574-138638596 CTGTGGCAGGAGTGGGGAGATGG - Intergenic
980893470 4:138838786-138838808 CAGGGTAAGGAGAGGGGCGCGGG - Intergenic
981521145 4:145663643-145663665 CAGTGAATGGAGAAGGGAGTGGG + Intergenic
981816739 4:148839660-148839682 CAGAGGAGGGAGAGGGTTGGGGG + Intergenic
982026327 4:151255999-151256021 CCGTGGAAAGAGAGGGGGAGAGG + Intronic
982134390 4:152259437-152259459 CAGAGGAAGGAGAGGGGTGCAGG - Intergenic
982668092 4:158291204-158291226 CACTGGCAGGAGGGAGGAGGAGG + Intergenic
982968319 4:161945172-161945194 CAGTGGAAGAAGAGAGCAGGAGG - Intronic
983026709 4:162746803-162746825 GAAGGGGAGGAGAGGGGAGGCGG + Intergenic
983653163 4:170053611-170053633 AAGAAGAAGGAGGGGGGAGGGGG - Intergenic
983981368 4:174001365-174001387 TAGTGGAGGGTGAGTGGAGGGGG - Intergenic
984695634 4:182776530-182776552 CACTGGAAAGAGGGAGGAGGGGG + Intronic
984702829 4:182829061-182829083 CTGGGGAGGCAGAGGGGAGGAGG + Intergenic
984856798 4:184202419-184202441 GAGTGGAACAGGAGGGGAGGAGG + Intronic
984911318 4:184676639-184676661 GAAGGGAAGGAGAAGGGAGGGGG - Intronic
984911483 4:184677040-184677062 AAGGGGAAGGGGAGGGGAGAAGG - Intronic
984952384 4:185017177-185017199 AAGGGGAAGGAGGGGGGCGGCGG - Intergenic
985106896 4:186508976-186508998 CAGAGGCAGGAGAGTAGAGGAGG + Intronic
985518933 5:361678-361700 CAGTAGGAAGAGAGGGGAGACGG - Intronic
985563700 5:604655-604677 CAGGGGCAGGAGGGGGGACGTGG + Intergenic
985572426 5:655597-655619 TAGTGGAGGGAGTGGGGTGGTGG + Intronic
985658113 5:1142465-1142487 AAGGGGAGGGGGAGGGGAGGGGG - Intergenic
985783991 5:1884849-1884871 AACTGCAAGGAGTGGGGAGGAGG - Intronic
985996794 5:3601404-3601426 CAGCAGCAGGAGCGGGGAGGGGG - Intergenic
986009623 5:3700583-3700605 GAGTGGAGGAAGGGGGGAGGAGG - Intergenic
986695815 5:10353750-10353772 GAGAGGAAGGAGAGGGGAGAGGG - Exonic
987226008 5:15842133-15842155 CAGTGAAAGCAGCTGGGAGGGGG + Intronic
987245163 5:16041525-16041547 CTGTGGGGGCAGAGGGGAGGGGG - Intergenic
987358258 5:17083687-17083709 GCGGGGAAGGGGAGGGGAGGGGG + Intronic
987859367 5:23464722-23464744 GAATGGAGGGAGAGGGGAGGGGG + Intergenic
987962678 5:24830724-24830746 GGGTGGGGGGAGAGGGGAGGGGG - Intergenic
988487993 5:31682839-31682861 CAGGGGAAAGGGAGGGGTGGAGG - Intronic
988632079 5:32942330-32942352 AAGGAGAAGGAGAAGGGAGGAGG + Intergenic
988801174 5:34698111-34698133 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
990332227 5:54739512-54739534 CAGTGGAGAGAGATGGGTGGAGG - Intergenic
990743700 5:58937232-58937254 CAGGGGAGGGGGAGGGGCGGGGG + Intergenic
990743715 5:58937261-58937283 CAGGGGAAGGGGAGGGGCGGGGG + Intergenic
990830504 5:59951928-59951950 CAGAGAAAGGAGAAGTGAGGAGG - Intronic
991640946 5:68751787-68751809 CAGAGAAAGAAGAGAGGAGGGGG + Intergenic
991957708 5:72012430-72012452 TAGAGGAGGAAGAGGGGAGGAGG - Intergenic
991980426 5:72224789-72224811 AAGTGAAAGTAGAGGGGAGAGGG - Intronic
991984976 5:72275857-72275879 AAGTGGAGGGAAAGGGGAAGGGG + Intronic
992149011 5:73882700-73882722 CAGGGGAAGAAGAAGGGAGGTGG + Intronic
992198109 5:74359570-74359592 CAGTGGAGGGTGAGGGGAAGGGG + Intergenic
992415999 5:76551885-76551907 GAGGGGAGGGGGAGGGGAGGGGG + Intronic
992547836 5:77832483-77832505 CAGTGGGACTAGAGGCGAGGAGG - Intronic
992605129 5:78448006-78448028 AGGGGGAAGGAGAGGGGAGGAGG - Intronic
992869298 5:80990425-80990447 CAGTGAAAGGAGTCGGGAGGGGG + Intronic
992944847 5:81799962-81799984 CAGTGCAGAGAGTGGGGAGGTGG + Intergenic
993315834 5:86404914-86404936 ATATGGAAGGAAAGGGGAGGAGG + Intergenic
993348543 5:86817761-86817783 TATTGGAGGGAAAGGGGAGGGGG - Intergenic
993554959 5:89325240-89325262 AAGTGGAAGGAAAGAGGAAGAGG - Intergenic
994135989 5:96287240-96287262 CAGTGGAAGGAAAGGGGAGGGGG - Intergenic
994438153 5:99764072-99764094 CTGTGGAAGGAGAGAGAAGCAGG - Intergenic
994714717 5:103307415-103307437 CAGTGGGAGGACAGAGGAGAAGG - Intergenic
994900647 5:105764510-105764532 CAGTGGAATTATATGGGAGGTGG + Intergenic
995063422 5:107835708-107835730 GGGTGGAAAGAGAGGGGAGAAGG + Intergenic
995140743 5:108732644-108732666 AAAAGGAAGGGGAGGGGAGGGGG - Intergenic
995199218 5:109409071-109409093 AAGTTGAAGCAAAGGGGAGGTGG - Intronic
996030751 5:118701978-118702000 CTTTGGAAGGAGGGGTGAGGGGG + Intergenic
996087355 5:119318683-119318705 GAGGGACAGGAGAGGGGAGGGGG - Intronic
996403932 5:123089031-123089053 CAGAAGAAGGGGAGGGGAGAGGG - Intergenic
997076888 5:130689552-130689574 GAGTGGACGGAGAGGGCTGGTGG - Intergenic
997131255 5:131278725-131278747 GAGGGGGAGGGGAGGGGAGGGGG - Intronic
997225752 5:132208390-132208412 GAGGGGAGGGGGAGGGGAGGGGG + Intronic
997225759 5:132208401-132208423 GAGGGGAGGGGGAGGGGAGGGGG + Intronic
997317957 5:132953754-132953776 CAGTGGAAAAAGAAGTGAGGAGG - Intronic
997581719 5:135021532-135021554 CAGTGGGAGGACAGGGGCAGTGG + Intergenic
997745387 5:136295544-136295566 CAGTGGACGGGGAGGGGACTGGG - Intronic
998374833 5:141683276-141683298 CAGGGGAAGAAGAGGGGAGTGGG + Intergenic
998522276 5:142812084-142812106 CAGTAGACGGGGTGGGGAGGGGG - Intronic
998552012 5:143086908-143086930 CAGTGGAGGTAGGGGGTAGGCGG - Intronic
998903463 5:146878970-146878992 GAGTGGCGCGAGAGGGGAGGAGG - Intronic
999175583 5:149629554-149629576 CAGTGACAGGAGAGGGCAGGAGG + Intronic
999182669 5:149681103-149681125 CAGGGGAGGGAGGAGGGAGGAGG - Intergenic
999325529 5:150641197-150641219 CAGTGGGAGGAATGGGGAAGGGG + Intronic
1000294523 5:159901434-159901456 GAGGGGAGGGGGAGGGGAGGGGG + Intergenic
1000463182 5:161547223-161547245 GGGTGGGAGGAGGGGGGAGGGGG + Intronic
1000606344 5:163331404-163331426 AAGTGGAGGGAAAGGGGAAGGGG + Intergenic
1001172990 5:169439117-169439139 CACTGGAAGGAGTGGGGAGATGG - Intergenic
1001397788 5:171429179-171429201 CCATGGATGGAAAGGGGAGGAGG - Intronic
1001622197 5:173096525-173096547 AAAGGGAAGGGGAGGGGAGGGGG - Intronic
1001625873 5:173132473-173132495 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
1001718862 5:173840180-173840202 GAGGAGAAGGAGAGGGCAGGAGG + Intergenic
1001935546 5:175701054-175701076 CAGTGGAGGGAAATGGGAAGGGG + Intergenic
1001945655 5:175775392-175775414 GAGGGGAAGGAGAGTGAAGGAGG - Intergenic
1001961924 5:175884649-175884671 GCATGGAAGGAGAGGGGTGGGGG - Intergenic
1002000689 5:176194878-176194900 CAGGGGCAGGAGCGGGGAGCGGG + Intergenic
1002001279 5:176197578-176197600 CAGAGGGAGGTGGGGGGAGGGGG - Intergenic
1002253060 5:177941391-177941413 CAGAGGGAGGTGGGGGGAGGGGG + Intergenic
1002253653 5:177944109-177944131 CAGGGGCAGGAGCGGGGAGCGGG - Intergenic
1002290059 5:178194292-178194314 CTGTGCAGGGAGAAGGGAGGTGG + Intergenic
1002436641 5:179235670-179235692 GAGAGGAAGGAGAGGGGAAGCGG + Intronic
1002443476 5:179276037-179276059 CTGTGGGAGGAGAGCGGAAGAGG + Intronic
1002493142 5:179593928-179593950 CAGTGGAGGGACAGTGAAGGTGG - Intronic
1003163073 6:3652616-3652638 GAGAGGAAGGAGCGGGGAGTTGG - Intergenic
1003234351 6:4282371-4282393 GGGTGGATGGAGCGGGGAGGGGG + Intergenic
1003285667 6:4731889-4731911 CTGTGGAAGGAGGGGGAAGATGG + Intronic
1003384194 6:5652296-5652318 CTGTGGCAGGATAGGGGATGGGG + Intronic
1003398023 6:5769949-5769971 CACTGGAAGGGGAGGTGAAGGGG + Intronic
1003410378 6:5856668-5856690 CAGGGGAGGAAGAGGAGAGGAGG + Intergenic
1003459612 6:6318097-6318119 CAATGGATGGAGGAGGGAGGAGG + Intronic
1003494941 6:6655503-6655525 CACTGGAAGGACAGGGGCGTCGG - Intergenic
1003985136 6:11427782-11427804 GACTGCAAGGAGAGGGGAGATGG + Intergenic
1004177731 6:13354734-13354756 CAAGGGAAGGAGAAGGGAGCAGG - Intergenic
1004205267 6:13586705-13586727 GAGAGGAAGGGAAGGGGAGGAGG + Intronic
1004317173 6:14599725-14599747 CTGAGGAAGGAGAGGTGGGGAGG + Intergenic
1004332940 6:14737843-14737865 CAGGGCAAGGGGAGGGGAGTGGG + Intergenic
1004404405 6:15318611-15318633 CCTTGTAAGGAAAGGGGAGGGGG - Intronic
1004495209 6:16156436-16156458 CAATGGCAGGAGAGTGAAGGTGG + Intergenic
1004578379 6:16922523-16922545 CAGTGGCAGGAGATGGGAGAGGG + Intergenic
1004787890 6:18989370-18989392 CAGAGCAAGGGGAGAGGAGGAGG - Intergenic
1005016259 6:21377981-21378003 CAGGGGAAGGAGAGGGATGAGGG + Intergenic
1005089185 6:22038490-22038512 GAGGAGAAGGAGAGGAGAGGAGG - Intergenic
1005183141 6:23130129-23130151 AAATTGAAGGAGATGGGAGGAGG + Intergenic
1005223859 6:23619793-23619815 AAGGGGAAGGAGAAGGGAAGGGG + Intergenic
1005290964 6:24378407-24378429 CAGAGGTAGGAGTGGGGTGGTGG - Intergenic
1005319831 6:24642132-24642154 GAGGGGAAGGGGAGGGAAGGAGG + Intronic
1005436964 6:25822961-25822983 CAGTGGTGGGGGAGGGCAGGAGG - Intronic
1005677760 6:28173197-28173219 CATTGGGAGGACAGGGCAGGAGG + Intergenic
1005936878 6:30529778-30529800 CAGTGGCAGAAGTGGAGAGGTGG + Intergenic
1006151628 6:31993022-31993044 CAGGGGAAGGGGAGGAGGGGAGG + Intronic
1006157929 6:32025760-32025782 CAGGGGAAGGGGAGGAGGGGAGG + Intronic
1006285359 6:33089093-33089115 AAGTGGAAGGAGGTGGGAGTTGG + Intergenic
1006303684 6:33207166-33207188 CAGAGAAAGGAGAGGGGTGGGGG - Intergenic
1006391076 6:33759026-33759048 CAGAGGCAGGATGGGGGAGGAGG + Intergenic
1006409054 6:33861715-33861737 CTCTGGATGGAGGGGGGAGGAGG + Intergenic
1006470751 6:34227373-34227395 CACTGGTGGGAGAGCGGAGGAGG - Intergenic
1006598212 6:35208951-35208973 CAGTGGAGAGAGAAGGGAGCAGG + Intergenic
1006648861 6:35534778-35534800 CAGTGGCAGGGGAGGGAGGGAGG - Intergenic
1006719809 6:36142860-36142882 CAGTGCAAGGTGGGGGGTGGAGG + Intronic
1006817674 6:36863911-36863933 CTGTGAAAGCAGAGGGGCGGAGG - Intronic
1006934532 6:37708158-37708180 AAATGGAAGGAGAAGGGAGATGG + Intergenic
1007177923 6:39909219-39909241 CAGGGGAGGGGGAGGGGAGAGGG + Intronic
1007359095 6:41342555-41342577 GAGTGGAAGGACAGGGGAGAGGG - Intronic
1007502255 6:42307293-42307315 CAGAGGAGTGTGAGGGGAGGAGG - Intronic
1007593200 6:43035915-43035937 CTATGGAAGGAGGGGGAAGGGGG - Intergenic
1007622062 6:43221350-43221372 GAGGGCAAGGAGGGGGGAGGAGG + Intronic
1007745872 6:44042670-44042692 CAGAGGAGGGAGGGGAGAGGAGG + Intergenic
1007768630 6:44176542-44176564 CGGTGGAAGGAGAGGGGCGGAGG - Intronic
1007769366 6:44180649-44180671 TAGTGGCAGGAGAGGTGAGCAGG + Exonic
1008125476 6:47663623-47663645 CAGTGTAAGGGGAGAGCAGGAGG + Intronic
1008160183 6:48067735-48067757 CAGTGAATGGAAGGGGGAGGGGG - Intronic
1008385122 6:50880372-50880394 TACAGGAAGGGGAGGGGAGGAGG - Intergenic
1008523069 6:52381037-52381059 CAGTGGGAGGAGGAGGGTGGGGG - Intronic
1008548562 6:52605280-52605302 CAGGGGCAGGGGAGGGTAGGAGG + Intergenic
1008581707 6:52913980-52914002 CAGTGGAAGGAGATGGGACAAGG + Intergenic
1008665180 6:53709140-53709162 CAGTGCAAGGAGAGAGGACAGGG - Intergenic
1008690259 6:53971073-53971095 CAATGTAAAGAGAAGGGAGGGGG + Intronic
1008966908 6:57322043-57322065 CAGTGGTTGGAGAAGGAAGGTGG + Intronic
1009408138 6:63333446-63333468 GAAGGGGAGGAGAGGGGAGGGGG + Intergenic
1011249150 6:85352678-85352700 CAGTGGGACAAGATGGGAGGTGG - Intergenic
1011352292 6:86435655-86435677 CAGTGCAGGGTGAGGTGAGGTGG - Intergenic
1011399833 6:86948550-86948572 CAGTGGGAGGTGAGAGGAAGTGG - Intronic
1011447742 6:87460626-87460648 CAGTGGAAAGAGTGGGAGGGGGG + Intronic
1011632364 6:89339599-89339621 GGGGGGAAGGAGAGGGGAGGGGG + Intronic
1012019527 6:93900139-93900161 GAGTGGAAGGAGAAAGGAGGAGG + Intergenic
1012278515 6:97301477-97301499 CAGTGGAAGGAGGGAAGAGTAGG - Intergenic
1012861520 6:104565830-104565852 GAGTGGAAGAAGAGGGAAGCAGG - Intergenic
1012981100 6:105831135-105831157 CAGTGGAAGGAGGGGAAGGGGGG + Intergenic
1013174261 6:107663882-107663904 CACTTGAAGGAGAGGGGCTGGGG + Intergenic
1013185475 6:107753992-107754014 GAGTGGGAGGACAGAGGAGGTGG + Intronic
1013223820 6:108104751-108104773 CAGAGGCATGAGAGAGGAGGTGG - Intronic
1013388358 6:109655864-109655886 CAGTGACAGGAGAGGTGGGGAGG + Intronic
1013410652 6:109880668-109880690 CAGTGGAAGGAGACCCGAGTGGG + Intergenic
1013467403 6:110429884-110429906 CAGTGGCATGGAAGGGGAGGAGG + Intronic
1013990703 6:116251645-116251667 AGGGGGAGGGAGAGGGGAGGAGG + Exonic
1014171254 6:118281504-118281526 CAGTAGAGGGAGATTGGAGGTGG + Intronic
1014176370 6:118335750-118335772 GGGAGGAAGGAGAGGGGAAGGGG + Intergenic
1014757152 6:125314112-125314134 TAGTGGAAGCACACGGGAGGTGG - Intergenic
1014867568 6:126550875-126550897 CAGGGGATGGAGTGGGAAGGTGG + Intergenic
1015058055 6:128928549-128928571 CCGTTCAAGGAGAGGGAAGGAGG + Intronic
1015155621 6:130092321-130092343 GAGAGGAAGGAGAGGAAAGGAGG - Intronic
1015840653 6:137473415-137473437 CAGAGGGAGGGGAGGGGCGGAGG + Intergenic
1016474836 6:144415886-144415908 AAGTGGAAGGACAGGGCTGGTGG + Intronic
1016785349 6:148005495-148005517 CAGGGAAAGGAAAGAGGAGGAGG + Intergenic
1016801478 6:148173519-148173541 AAGGGGAAGAAGGGGGGAGGAGG + Intergenic
1016873179 6:148838792-148838814 CAGAGGAAGAAGAGTAGAGGCGG + Intronic
1016882754 6:148927190-148927212 AAGGGGAGGGAAAGGGGAGGAGG + Intronic
1017259677 6:152371686-152371708 GAGGGGGAGGAGAGGGGAAGGGG + Intronic
1017588569 6:155953692-155953714 CTGTGGAAGTGGAGGGGAGCTGG + Intergenic
1017637345 6:156456162-156456184 GAGGGGGAAGAGAGGGGAGGAGG - Intergenic
1017717978 6:157225271-157225293 CAGTGCAAGGATTGGGGATGTGG - Intergenic
1017864356 6:158429959-158429981 AAGGGGCAGGAGAGGGGAGCTGG + Intronic
1017948493 6:159116162-159116184 CAGGGGATGGAGTGGGAAGGTGG - Intergenic
1018020939 6:159761936-159761958 CAGTGGGATGCGCGGGGAGGTGG + Exonic
1018038075 6:159898652-159898674 AAGAGGAAGGAGGAGGGAGGAGG - Intergenic
1018431915 6:163729515-163729537 CAGAGGAAGGTGAGAGTAGGTGG + Intergenic
1018542891 6:164902134-164902156 AAGTGGAAAGAGGGTGGAGGTGG + Intergenic
1018710806 6:166497103-166497125 CAGTGGAAGGAAAGCAGAGGTGG + Intronic
1018839586 6:167508241-167508263 GACAGGAAGGAGAGGGGATGGGG - Intergenic
1018842130 6:167524986-167525008 CAGGGGAAGGAGGGGGCAGCAGG - Intergenic
1018898916 6:168041252-168041274 CAAGGGAAGGAGAGGTGACGGGG + Intronic
1018931857 6:168245243-168245265 CAGTGGCAAGAGTGGGGATGGGG - Intergenic
1018950242 6:168374297-168374319 CAGTGGCAGAAGAGGGATGGCGG - Intergenic
1019320659 7:414087-414109 AAGGGGAAGAGGAGGGGAGGAGG - Intergenic
1019494915 7:1333348-1333370 GAGGGGGAGGAGGGGGGAGGAGG - Intergenic
1019502730 7:1372928-1372950 GTGAGGAAGGAGAGCGGAGGAGG + Intergenic
1019517547 7:1446524-1446546 GAAGGGGAGGAGAGGGGAGGAGG + Intronic
1019551701 7:1606586-1606608 GAGTGGGAGGAGAAGGGAAGGGG - Intergenic
1019551731 7:1606659-1606681 AGGGGGAAGGGGAGGGGAGGAGG - Intergenic
1019551748 7:1606695-1606717 AGGGGGAAGGGGAGGGGAGGAGG - Intergenic
1019816366 7:3204045-3204067 CAGGAGGAGGAGAGAGGAGGAGG + Intergenic
1020080026 7:5282203-5282225 AAGGGGAAGGAGAGGGAGGGAGG + Intronic
1020852935 7:13379337-13379359 GGGTGGGGGGAGAGGGGAGGGGG + Intergenic
1021120597 7:16791053-16791075 CCGTGGAAAGAGGGGGGGGGGGG + Intergenic
1021697127 7:23286348-23286370 GAGTGGAAGGAGGGGGGAGAGGG - Intergenic
1021776378 7:24059038-24059060 CAGCGAAAGGAGAGAGAAGGAGG + Intergenic
1022021007 7:26399093-26399115 CTGGGGAAGGAAAGAGGAGGCGG - Intergenic
1022049092 7:26647742-26647764 CAGAGGCAGGTGAGGGGAGATGG - Intergenic
1022506131 7:30909641-30909663 CAGGGACAGGTGAGGGGAGGAGG + Intergenic
1022970697 7:35514212-35514234 CAGTGGAAGGGGTGGGGAGAGGG - Intergenic
1023130457 7:36997740-36997762 CAGTGGTAGGAGAGGAAAAGAGG + Intronic
1023382771 7:39624213-39624235 GAGTGGAAAGAAAGGGAAGGAGG - Intronic
1023525804 7:41101584-41101606 CTGTGAAAGGATAGGGGAGCAGG + Intergenic
1023593986 7:41809704-41809726 CATTGACAGGAGAGGAGAGGTGG + Intergenic
1024268677 7:47625935-47625957 CAGTGAACCGAGATGGGAGGGGG - Intergenic
1024331142 7:48156466-48156488 CAGAGGATGGAAAGAGGAGGAGG + Intergenic
1024644983 7:51363372-51363394 CCATGGAAGGACAGGGGAGATGG + Intergenic
1024683876 7:51723705-51723727 CAATGAAAGGAAAGGGAAGGGGG - Intergenic
1025198890 7:56950013-56950035 AAGGGGAAGGAGAGGGAGGGAGG - Intergenic
1025673056 7:63626920-63626942 AAGGGGAAGGAGAGGGAGGGAGG + Intergenic
1025814068 7:64893688-64893710 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
1026004635 7:66591569-66591591 CAGTTGAGGGAGAGAGAAGGGGG - Intergenic
1026191915 7:68136515-68136537 GAGGGGAAGGAGGAGGGAGGAGG + Intergenic
1026191923 7:68136534-68136556 GAGGGGAAGGAGGAGGGAGGAGG + Intergenic
1026335382 7:69390002-69390024 GAGTGGAAGGAGAGGAGAAATGG - Intergenic
1026434452 7:70383183-70383205 CAGTAGAAGATGAGAGGAGGAGG + Intronic
1026560481 7:71444328-71444350 CATAGGAAGGAAAGGGGAAGTGG - Intronic
1026762549 7:73137725-73137747 GAGGGGAGGGAGAGGGGAAGGGG + Intergenic
1026762568 7:73137770-73137792 GAGGGGAAGGAGAGGGGAAGGGG + Intergenic
1026762576 7:73137792-73137814 GAGGGGAAGGAGAGGAGAAGGGG + Intergenic
1026762584 7:73137814-73137836 GAGGGGAAGGAGAGGAGAAGGGG + Intergenic
1026762592 7:73137836-73137858 GAGGGGAAGGAGAGGAGAAGGGG + Intergenic
1026762600 7:73137858-73137880 GAGGGGAAGGAGAGGAGAAGGGG + Intergenic
1026762610 7:73137880-73137902 GAGGGGAAGGAGAGGGGAAGGGG + Intergenic
1026876910 7:73884688-73884710 CAGTGAAAGCTGATGGGAGGAGG - Intergenic
1026913967 7:74108765-74108787 CAGAGGCAGGAGAGGGGAGCTGG + Intronic
1026938082 7:74270361-74270383 GAGAGGAAGGAGGGGAGAGGAGG - Intergenic
1026957881 7:74389246-74389268 CTGCGGAAGGAGCGGTGAGGCGG + Exonic
1026960388 7:74404127-74404149 CAGTGGAGGCAGAGGGGATCCGG + Exonic
1027039012 7:74947501-74947523 GAGGGGAGGGAGAGGGGAAGGGG + Intergenic
1027039031 7:74947546-74947568 GAGGGGAAGGAGAGGGGAAGGGG + Intergenic
1027039039 7:74947568-74947590 GAGGGGAAGGAGAGGAGAAGGGG + Intergenic
1027039047 7:74947590-74947612 GAGGGGAAGGAGAGGAGAAGGGG + Intergenic
1027039055 7:74947612-74947634 GAGGGGAAGGAGAGGAGAAGGGG + Intergenic
1027039063 7:74947634-74947656 GAGGGGAAGGAGAGGAGAAGGGG + Intergenic
1027039073 7:74947656-74947678 GAGGGGAAGGAGAGGGGAAGGGG + Intergenic
1027039083 7:74947678-74947700 GAGGGGAAGGAGAGGGGAAGGGG + Intergenic
1027084556 7:75254688-75254710 GAGGGGAAGGGGAGGGGAAGGGG - Intergenic
1027084562 7:75254699-75254721 GAGGGGAAGGGGAGGGGAAGGGG - Intergenic
1027084568 7:75254710-75254732 GAGGGGAAGGAGAGGGGAAGGGG - Intergenic
1027084578 7:75254732-75254754 GAGGGGAAGGAGAGGGGAAGGGG - Intergenic
1027084588 7:75254754-75254776 GAGGGGAAGGAGAGGAGAAGGGG - Intergenic
1027084596 7:75254776-75254798 GAGGGGAAGGAGAGGAGAAGGGG - Intergenic
1027084604 7:75254798-75254820 GAGGGGAAGGAGAGGGGAAGGGG - Intergenic
1027084614 7:75254820-75254842 GAGGGGAAGGAGAGGAGAAGGGG - Intergenic
1027084622 7:75254842-75254864 GAGGGGAAGGAGAGGAGAAGGGG - Intergenic
1027084630 7:75254864-75254886 GAGGGGAAGGAGAGGAGAAGGGG - Intergenic
1027084638 7:75254886-75254908 GAGGGGAAGGAGAGGAGAAGGGG - Intergenic
1027084646 7:75254908-75254930 GAGGGGAAGGAGAGGGGAAGGGG - Intergenic
1027084656 7:75254930-75254952 GAGGGGAAGGAGAGGGGAAGGGG - Intergenic
1027084675 7:75254975-75254997 GAGGGGAGGGAGAGGGGAAGGGG - Intergenic
1027138216 7:75639243-75639265 AAGGGGAGGGGGAGGGGAGGCGG + Intronic
1027162545 7:75813264-75813286 ACGTGGCAGGAGAGGGGTGGGGG - Intronic
1027176876 7:75909696-75909718 AAGAGGAAGGAGAGGAGAAGAGG + Intronic
1027194699 7:76021670-76021692 CCGAGCAAGGAGATGGGAGGAGG - Intronic
1027545998 7:79528467-79528489 CAGGGAAAGAAGAGGGGATGAGG - Intergenic
1027633305 7:80636164-80636186 CAGAGAACGGAGAGGGGAGGAGG + Intronic
1028328600 7:89559663-89559685 CAGGGGAAGGAGGGGACAGGAGG + Intergenic
1028362281 7:89983764-89983786 TGGTGGGGGGAGAGGGGAGGGGG - Intergenic
1028688209 7:93617727-93617749 CACTGGAATGAGAGAGTAGGTGG + Intronic
1028809637 7:95069428-95069450 AAATGGAAGGAGAGGGAAGGAGG + Intronic
1028881961 7:95890429-95890451 CGGTGGAGGGTGAGAGGAGGAGG + Intronic
1029054866 7:97731798-97731820 GTTTCGAAGGAGAGGGGAGGGGG + Intergenic
1029195461 7:98802390-98802412 GGGTGGGAGGAAAGGGGAGGAGG + Intergenic
1029481726 7:100817421-100817443 GAGTGGAGGGCGAGGGAAGGAGG - Intronic
1029550733 7:101235914-101235936 CACAGGCAGGAGAGGGGAGCCGG - Intronic
1029981552 7:104884261-104884283 AAGTGGAAGGAAAGAGGAAGGGG - Intronic
1030130252 7:106193787-106193809 CAGTGGAAGGAGGGAGTCGGTGG - Intergenic
1030327057 7:108230806-108230828 CAGTGGGAGGAGATAGGAGTGGG - Intronic
1030347328 7:108449358-108449380 CAGTGAAGGGAGGGGGGAGCTGG - Intronic
1030537260 7:110784371-110784393 ATGTGGAAGGGGAGGGGAGGAGG - Intronic
1031041167 7:116839800-116839822 GAGGGGATGGAGAGAGGAGGTGG + Intronic
1031895758 7:127346823-127346845 CTGTGAAAGGAGAGGGGAACTGG + Intronic
1031906714 7:127467950-127467972 AAGAGGAAGGAGAGAGGAGAGGG + Intergenic
1031995777 7:128229906-128229928 CACTGGCAGGGGAGGGAAGGAGG + Intergenic
1032058244 7:128701324-128701346 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
1032423774 7:131803841-131803863 GAGTGGAAGGCGAAGGGAAGTGG - Intergenic
1032938419 7:136760858-136760880 CAGTGGAAGGTGAAGGGGAGTGG - Intergenic
1033271341 7:139935700-139935722 GGGTGGAGGGAGAGGGAAGGGGG - Intronic
1033326527 7:140383645-140383667 TAGTGGAAGGAGATGGCAAGGGG - Intronic
1033354933 7:140591967-140591989 GAGAGGAGGGAGAGGGGAGGGGG - Intronic
1033354946 7:140591994-140592016 GAGAGGAGGGAGAGGGGAAGGGG - Intronic
1033890430 7:146006398-146006420 CAGGGGGAGGATGGGGGAGGAGG - Intergenic
1034268270 7:149791495-149791517 CTGTGGAAGGCCAGGGCAGGTGG + Intergenic
1034277688 7:149830804-149830826 CTGTGGAAGGACACAGGAGGAGG - Intergenic
1034307790 7:150059590-150059612 TAGAGGAAGGACAGAGGAGGAGG + Intergenic
1034422278 7:150996170-150996192 CAGGGGTGGGAGAGGGGAGAGGG - Intronic
1034437428 7:151069878-151069900 CAGTGGCAGGAGATGGGATGGGG - Intronic
1034474153 7:151273282-151273304 CAGGGGAAGGAGGGCAGAGGAGG - Intronic
1034541195 7:151759333-151759355 CAGTCAAAGGAGAGGGGCTGCGG - Intronic
1034551708 7:151824848-151824870 CAGAAGAAAGAGAGGGAAGGGGG - Intronic
1034799057 7:154041079-154041101 TAGAGGAAGGACAGAGGAGGAGG - Intronic
1034975950 7:155449393-155449415 CCGTGCGAGGGGAGGGGAGGGGG - Intergenic
1035350494 7:158242188-158242210 CAGAGGACGGGGCGGGGAGGAGG - Intronic
1035521201 8:276062-276084 TAGGGGAAGGAGAGGGGAAGTGG + Intergenic
1035560537 8:600998-601020 CAGTGGAAGGCGTTGGGAGTGGG + Intergenic
1035560557 8:601078-601100 CAGTGGAAGGCGTTGGGAGTGGG + Intergenic
1035560597 8:601238-601260 CAGTGGAAGGCGTTGGGAGTGGG + Intergenic
1035560618 8:601318-601340 CAGTGGAAGGCGTTGGGAGTGGG + Intergenic
1035560639 8:601398-601420 CAGTGGAAGGCGCTGGGAGTGGG + Intergenic
1035598438 8:880163-880185 CAGTGGAGGGAGAAGGGGCGGGG - Intergenic
1035714279 8:1741967-1741989 AAGAGGACGGCGAGGGGAGGAGG + Intergenic
1035917969 8:3645483-3645505 CAGTGGAAGAAATGGGGAAGGGG + Intronic
1035957681 8:4100364-4100386 AGGTGGAAGGAGATGGGTGGTGG - Intronic
1036134666 8:6149666-6149688 CAGGAGCAAGAGAGGGGAGGGGG + Intergenic
1036158262 8:6362613-6362635 CAGTAGCAGGAGAGGAGTGGAGG - Intergenic
1036364815 8:8111027-8111049 CCATGGAAGGAGCTGGGAGGGGG + Intergenic
1036626975 8:10480238-10480260 CGGTGGGAGAAGAGGCGAGGGGG + Intergenic
1037057042 8:14455974-14455996 CAGTTGGAGGGGAGGGGATGCGG + Intronic
1037179440 8:15987076-15987098 GGGTGGGAGGAGGGGGGAGGGGG + Intergenic
1037560542 8:20070436-20070458 CAGTGGAACAGGAGTGGAGGGGG - Intergenic
1037581960 8:20250689-20250711 CAGGAGAATCAGAGGGGAGGCGG - Intronic
1037616115 8:20520294-20520316 GAGGGGAAGGAGAGTGGAGCTGG - Intergenic
1037670800 8:21013601-21013623 CAGAGGAAGGAGGGGGGTGCAGG - Intergenic
1037674691 8:21043244-21043266 TGGTGGAAGGTGGGGGGAGGTGG - Intergenic
1037674816 8:21043528-21043550 TGGTGGAAGGTGGGGGGAGGTGG - Intergenic
1037674978 8:21043878-21043900 TGGTGGAAGGTGGGGGGAGGTGG - Intergenic
1038042631 8:23737979-23738001 AAGGGGAAGGGGTGGGGAGGAGG - Intergenic
1038053687 8:23837677-23837699 GAGGGGAAGCAGAGGGGAGCAGG + Intergenic
1038148010 8:24915496-24915518 AAGTGGAGGGAGACGGGAGGAGG + Intronic
1038248907 8:25884361-25884383 ATGTGGATGGAGAGGAGAGGAGG + Intronic
1038675090 8:29616130-29616152 GAAAGGAAGGAGAGGGAAGGAGG + Intergenic
1038699357 8:29835526-29835548 CAGGGGATGGTGTGGGGAGGAGG - Intergenic
1039475095 8:37835466-37835488 CAGTGAGAGGAGGTGGGAGGAGG + Intronic
1039476817 8:37843123-37843145 GAGTAGAGGGAGAGGGCAGGTGG + Exonic
1039658791 8:39439538-39439560 GAGGGGGAGGGGAGGGGAGGGGG - Intergenic
1039791781 8:40882026-40882048 CAGCTGAAGGAAAGGTGAGGAGG + Intronic
1039884071 8:41645643-41645665 GGGTGCAGGGAGAGGGGAGGCGG - Exonic
1039884227 8:41646278-41646300 CAGGGGAGGAGGAGGGGAGGCGG - Exonic
1039888185 8:41667322-41667344 GAGAGGAAGGAGAGGAGAGGAGG + Intronic
1040387087 8:46921016-46921038 CAGTTACAGGGGAGGGGAGGAGG + Intergenic
1040517178 8:48144648-48144670 CAGTGGATGGGCAGGGGAAGTGG - Intergenic
1041107825 8:54459030-54459052 CAGTGGAAGGAAGGGGGAGAGGG - Intronic
1041186774 8:55308930-55308952 CAGTGGAAGCTGAAGAGAGGAGG + Intronic
1041403338 8:57468247-57468269 TAGTGGAAGGAGAGGGGACAAGG + Intergenic
1041456631 8:58067459-58067481 CAGTGGATGGAGGAGGAAGGAGG - Intronic
1041524384 8:58789179-58789201 CTGTGGAACAAGAGGGAAGGAGG + Intergenic
1041654438 8:60335062-60335084 CAGAGGATGCAGAGGGAAGGGGG + Intergenic
1041669156 8:60475611-60475633 GAAGGGGAGGAGAGGGGAGGAGG - Intergenic
1041686375 8:60648746-60648768 CAGAAGATGGAGAAGGGAGGAGG - Intergenic
1041947981 8:63468245-63468267 GAGTGGAAGGAAAGGAGAGAAGG - Intergenic
1042530176 8:69806639-69806661 CAGTGGGAAGGGAGTGGAGGTGG - Intronic
1042942185 8:74118737-74118759 GAGGGAAAGGAGAGGAGAGGAGG - Intergenic
1043256294 8:78141906-78141928 AAGAGGAAGAAGATGGGAGGAGG - Intergenic
1043296384 8:78668158-78668180 TAGGGGAGGGAGAGGGGAGAAGG - Intronic
1043400888 8:79883128-79883150 GTGTGGAAGGAGAGGCAAGGAGG - Intergenic
1043566923 8:81558931-81558953 CAGGGGAAGGACAGAGAAGGAGG + Intergenic
1043961787 8:86424834-86424856 GAGGGGGAGGGGAGGGGAGGGGG + Intronic
1044014158 8:87030837-87030859 GAGAGGGAGGAGAGGGGAGGGGG - Intronic
1044080016 8:87872326-87872348 CAGTGGGAGAGGAGAGGAGGGGG - Exonic
1044293179 8:90496790-90496812 CAATGGATGGGGAGGGGACGGGG - Intergenic
1044327917 8:90881576-90881598 AGGAGGAAGGAGAGGGGCGGAGG - Intronic
1044473263 8:92597155-92597177 CACTGGAAGGAGAGGGAGGGAGG + Intergenic
1044670115 8:94671469-94671491 AAGTGGAATGAGAGGGGCCGAGG - Exonic
1044722954 8:95168465-95168487 CAGTGGAGAGAGAGGGGTTGAGG + Intergenic
1044797133 8:95914319-95914341 TAGAGGAAGGAGAGGTGAAGGGG + Intergenic
1044932032 8:97260152-97260174 AGGGGGAAGGGGAGGGGAGGGGG + Intergenic
1044932041 8:97260169-97260191 AGGGGGAGGGAGAGGGGAGGGGG + Intergenic
1044932048 8:97260180-97260202 GAGGGGAGGGGGAGGGGAGGGGG + Intergenic
1044973003 8:97638188-97638210 CAGTGGAAGGAGAAGGAACTAGG + Intergenic
1045046040 8:98279517-98279539 CAGTGAAAGGACAGGGAAGTGGG - Intronic
1045108917 8:98920845-98920867 CAGTGCAAAGAGCTGGGAGGAGG + Intronic
1045222822 8:100215170-100215192 CAGAGGATGGAAAGGGTAGGGGG - Intronic
1045231990 8:100314678-100314700 CAGGCAGAGGAGAGGGGAGGGGG - Intronic
1045305068 8:100951424-100951446 CGGCCGAGGGAGAGGGGAGGGGG + Intronic
1045412080 8:101929530-101929552 GAGGGAAAGGAAAGGGGAGGGGG + Intronic
1045819401 8:106318474-106318496 GGGTGGAAGGAGTGGGGAAGAGG - Intronic
1046026844 8:108734578-108734600 GAGTTGAAGTAGTGGGGAGGAGG - Intronic
1046115661 8:109780260-109780282 CAGAGGAAGAAGAGGTGAGAAGG - Intergenic
1046612888 8:116445254-116445276 CAGGAGGAGGAGAGAGGAGGGGG + Intergenic
1046616387 8:116482157-116482179 CAGCAGCAGGAGAGGGCAGGAGG - Intergenic
1046966076 8:120167208-120167230 CAGTGGAAAGAAAGGGGAGGAGG + Intronic
1047317595 8:123748324-123748346 GAGGGGAAGGAGAGGGAAAGGGG + Intergenic
1047367222 8:124222648-124222670 CAGTGGAAGGAGAGGGTAACAGG - Intergenic
1047614606 8:126553933-126553955 CAGAGGAAGAAGACGGGTGGGGG + Exonic
1047816567 8:128470673-128470695 TACTGGAAGGTGAGGGAAGGTGG - Intergenic
1047937599 8:129797734-129797756 CAGTGGGAAGAGAGAGAAGGGGG + Intergenic
1048098064 8:131315724-131315746 CAGTGAAGGGAGATGGGATGGGG - Intergenic
1048151588 8:131900386-131900408 TGGTGGAAGGGGAAGGGAGGAGG + Intergenic
1048260099 8:132937988-132938010 GAGTGGAGGAGGAGGGGAGGAGG + Intronic
1048860696 8:138722763-138722785 TAGTGGAAGGAGCCTGGAGGTGG - Intronic
1049060497 8:140272724-140272746 CAGTGAGGGGAGAGGGGAGGAGG + Intronic
1049170481 8:141157621-141157643 CATTGGGAGGAGTGGGAAGGAGG + Intronic
1049282734 8:141758728-141758750 CAGGGGAGGGAGAGCTGAGGAGG - Intergenic
1049465758 8:142750618-142750640 CGGTGGGAGGAGAGAGGAAGAGG - Intronic
1049555512 8:143279438-143279460 CGGAGGAGGGAGAGGGGTGGTGG - Intergenic
1049855864 8:144861510-144861532 CTTTGGTAGGAGAGGGGAGGAGG + Intergenic
1050309620 9:4339799-4339821 AAGGGGGAGGGGAGGGGAGGGGG + Intronic
1050309639 9:4339828-4339850 GAGGGGGAGGGGAGGGGAGGGGG + Intronic
1050840719 9:10145360-10145382 AGGAGGAAGAAGAGGGGAGGTGG - Intronic
1051642749 9:19238590-19238612 GAGGGGGAGGGGAGGGGAGGAGG - Intronic
1051896725 9:21995540-21995562 ATGTGGAAGAAAAGGGGAGGAGG - Intronic
1052026441 9:23578104-23578126 CTTTTGGAGGAGAGGGGAGGTGG - Intergenic
1052312136 9:27078898-27078920 CAGAGGAAGGAGTGGAGATGAGG + Intergenic
1052349321 9:27442519-27442541 CATTGGCAGGAGACTGGAGGAGG + Intronic
1052738437 9:32369654-32369676 GAGGAGAAGGAGAAGGGAGGAGG + Intergenic
1052822189 9:33146206-33146228 CAGCGGAAGGAGTGAGAAGGAGG - Intronic
1052854741 9:33400277-33400299 CAGAGCAAGGAGAGGGGAATTGG + Intronic
1052866283 9:33466426-33466448 CTGTGGAAGAAGAGGGGCTGAGG + Intronic
1052985395 9:34483146-34483168 GTGTGGAAGGAGAGGCGTGGAGG - Intronic
1053022633 9:34706274-34706296 CAGTGACAGGAGAGGAGAGTTGG + Intergenic
1053480547 9:38413434-38413456 CAGTGGGAGGAGGAGGAAGGAGG - Intronic
1053567595 9:39269426-39269448 GGATGGAAGGAGAGGGGAAGGGG + Intronic
1053595019 9:39551809-39551831 AAGAGGAAAGAGGGGGGAGGGGG - Intergenic
1053642467 9:40098498-40098520 GAGGGGAAGGGGAGGGGAAGGGG + Intergenic
1053642473 9:40098509-40098531 GAGGGGAAGGGGAGGGGAAGGGG + Intergenic
1053674313 9:40407809-40407831 CAGTGGGAGGAGAGGAAAAGGGG + Intergenic
1053682761 9:40496558-40496580 CAGAGCAAGGAGAGGGGAATTGG + Intergenic
1053833607 9:42110375-42110397 GGATGGAAGGAGAGGGGAAGGGG + Intronic
1053852801 9:42306837-42306859 AAGAGGAAAGAGGGGGGAGGGGG - Intergenic
1054129548 9:61349572-61349594 GGATGGAAGGAGAGGGGAAGGGG - Intergenic
1054280953 9:63128371-63128393 CAGAGCAAGGAGAGGGGAATTGG - Intergenic
1054295861 9:63332072-63332094 CAGAGCAAGGAGAGGGGAATTGG + Intergenic
1054385421 9:64547876-64547898 CAGTGGGAGGAGAGGAAAAGGGG + Intergenic
1054393878 9:64636567-64636589 CAGAGCAAGGAGAGGGGAATTGG + Intergenic
1054428527 9:65141780-65141802 CAGAGCAAGGAGAGGGGAATTGG + Intergenic
1054501852 9:65879765-65879787 CAGAGCAAGGAGAGGGGAATTGG - Intronic
1054510308 9:65968481-65968503 CAGTGGGAGGAGAGGAAAAGGGG - Intergenic
1054542287 9:66278135-66278157 GAGGGGAAGGAGAGGGGAAGGGG - Intergenic
1054571233 9:66813164-66813186 AAGAGGAAAGAGTGGGGAGGGGG + Intergenic
1054596944 9:67077037-67077059 CGATGGAAGGAGAGGGGAAGGGG - Intergenic
1054850639 9:69843441-69843463 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
1054850646 9:69843452-69843474 AAGTAGGAGGGGAGGGGAGGGGG - Intronic
1055449503 9:76418132-76418154 AAGTGGGCAGAGAGGGGAGGAGG + Intergenic
1055787576 9:79886577-79886599 CAGTGAAAGGAGAGCAGAAGAGG - Intergenic
1056482065 9:87015928-87015950 AAGTGGGAGGGGAGGGGTGGGGG + Intergenic
1056546853 9:87620573-87620595 AGGGGGAGGGAGAGGGGAGGAGG + Intronic
1056552775 9:87664877-87664899 ATGTGGAGGGAGACGGGAGGAGG - Intronic
1056672247 9:88640181-88640203 CAGCTGGAGGAGAGAGGAGGAGG + Intergenic
1056760000 9:89407730-89407752 CAGTGGAGGGAGTGTGGATGAGG - Intronic
1056905931 9:90647862-90647884 TAGTGGAAGGTCTGGGGAGGAGG - Intergenic
1056970478 9:91196703-91196725 CTGTGGAAAGACAGGGGAGCCGG - Intergenic
1057767434 9:97934434-97934456 GAGGGGGAGGGGAGGGGAGGGGG + Intronic
1057882575 9:98803621-98803643 TATTGGAAGGAGAGAGCAGGGGG + Intergenic
1058389056 9:104473505-104473527 GAATGGAAGTAGAAGGGAGGAGG - Intergenic
1058407353 9:104691689-104691711 AAGTGGAAGGAAAGAAGAGGTGG - Intergenic
1058545134 9:106053019-106053041 CAACGGAAGGAAAGGGGAGCAGG + Intergenic
1058601351 9:106674232-106674254 CAGAGGAGGGAAGGGGGAGGCGG - Intergenic
1058749245 9:108022934-108022956 TAGTGGAAGGAAGAGGGAGGAGG + Intergenic
1059327810 9:113514897-113514919 CAGAGAAAGGGGAGGCGAGGTGG - Intronic
1059398613 9:114054614-114054636 CAGTGGAAGAACTGGGAAGGAGG + Exonic
1059656757 9:116364748-116364770 CAGTGGAGAAAGAGGGGAAGGGG + Intronic
1059764651 9:117372233-117372255 CATTGGAAAGAGAGAGGAAGAGG - Intronic
1059771938 9:117434851-117434873 AAGTGGAAGGGGAAGTGAGGAGG + Intergenic
1059786991 9:117596901-117596923 TAGTGGGAGGAGAGGGGAGGGGG - Intergenic
1059842210 9:118230275-118230297 CAATGGAAGGAGAGGAAAGAAGG - Intergenic
1060102777 9:120855518-120855540 CAGTGGTAGGAGTGGCAAGGTGG + Intergenic
1060124050 9:121024318-121024340 GAGGGGAGGGGGAGGGGAGGGGG + Intronic
1060185294 9:121560425-121560447 GAGGGGAAAGAGATGGGAGGAGG + Intergenic
1060234157 9:121850541-121850563 AAGGGGGAGGAGTGGGGAGGTGG + Intronic
1060369828 9:123058038-123058060 CCGTGGAAAGAGAGGGGAGAGGG + Intronic
1060690920 9:125659436-125659458 CAAAGGAGGAAGAGGGGAGGAGG - Intronic
1060698631 9:125731460-125731482 CTGGGGAAGTAGAGGGGATGGGG - Intergenic
1060736205 9:126067960-126067982 CAGAGCAAGGAGAGGGGAGCAGG + Intergenic
1060835353 9:126751563-126751585 CTGTGAAAGGAGAAAGGAGGAGG - Intergenic
1060894892 9:127211267-127211289 CAGGTGGAGGAGAGGAGAGGGGG + Intronic
1060909300 9:127336395-127336417 AAATGGAAGGAGAGAGGAAGGGG - Intronic
1061130135 9:128703798-128703820 CAGAGGAAGGGGGTGGGAGGGGG - Intronic
1061366901 9:130176941-130176963 GAGGAGAAGGAGAAGGGAGGAGG - Intronic
1061389623 9:130310201-130310223 CAGGGGAAGTCCAGGGGAGGCGG + Intronic
1061390563 9:130315239-130315261 GAGGGGAAGGGGAGGGGAAGGGG - Intronic
1061390569 9:130315250-130315272 GAGGGGAAGGGGAGGGGAAGGGG - Intronic
1061391744 9:130320686-130320708 CTGGGGAGGGAGAGGGGAGCAGG + Intronic
1061488222 9:130931041-130931063 TAGAGGAAGGAGAGAGGATGGGG - Intronic
1061492112 9:130951091-130951113 CGCTGGAAGGGGAGTGGAGGGGG - Intergenic
1061716238 9:132520131-132520153 GAGTGAGAGGAGAGGGGAGGGGG - Intronic
1061792014 9:133063888-133063910 CTGTGCAGGGAGATGGGAGGAGG + Intronic
1061798744 9:133103070-133103092 CACTGGAGGGTGAGGGTAGGAGG - Intronic
1061858321 9:133455264-133455286 CACTGCCAAGAGAGGGGAGGAGG - Exonic
1061885691 9:133590115-133590137 GAGGGGAAGGGGAGGGGAAGGGG - Intergenic
1061885697 9:133590126-133590148 GAGGGGAAGGGGAGGGGAAGGGG - Intergenic
1061885703 9:133590137-133590159 GAGGGGAAGGGGAGGGGAAGGGG - Intergenic
1061885709 9:133590148-133590170 GAGGGGAAGGGGAGGGGAAGGGG - Intergenic
1061932487 9:133840412-133840434 CAGGGGCAGGAGTGGGGAGTGGG - Intronic
1062050502 9:134444396-134444418 GAGGGGAAGGAGGAGGGAGGGGG - Intergenic
1062052460 9:134454678-134454700 CTGAGGCAGGAGAGGGGAGGAGG - Intergenic
1062126149 9:134864122-134864144 CAGGGGAGGGAGAGGGAAGCAGG - Intergenic
1062159868 9:135074392-135074414 GAGAGGGAGGAAAGGGGAGGAGG + Intergenic
1062362757 9:136195450-136195472 CAGTGGACGGGGAGGGAAGGTGG - Intergenic
1062403774 9:136383863-136383885 CAGGAGGAGGGGAGGGGAGGGGG - Intronic
1062488247 9:136791638-136791660 CAGAGGAGGGACAGGAGAGGCGG + Intronic
1062548916 9:137077212-137077234 CAGGGGACGGAGAGGGACGGGGG + Intergenic
1062614649 9:137390882-137390904 CAGTGGACGCTGAGGGCAGGGGG + Intronic
1062640572 9:137516060-137516082 GGGTGGAAGGGGTGGGGAGGAGG - Intronic
1062701198 9:137904667-137904689 CAGCAGGAGGAGGGGGGAGGCGG - Intronic
1203743349 Un_GL000218v1:21053-21075 CATAGGAGTGAGAGGGGAGGAGG - Intergenic
1185449515 X:275082-275104 CAGTGAAGGGAGGAGGGAGGAGG + Intergenic
1185459786 X:328784-328806 GAGGGCAGGGAGAGGGGAGGGGG - Intergenic
1185485863 X:481580-481602 CGGAGGAAGGAGAGGGAGGGAGG + Intergenic
1185485880 X:481635-481657 CGGAGGAAGGAGAGGGAGGGAGG + Intergenic
1185490942 X:516579-516601 CAGTGAGAGGAGGGGGGAGAAGG - Intergenic
1185502493 X:608448-608470 GAGGGGAGGGGGAGGGGAGGGGG - Intergenic
1185502500 X:608459-608481 GAGGGGAGGGGGAGGGGAGGGGG - Intergenic
1185511526 X:668006-668028 AAGGGGAAGGAGAGGGGAGGAGG - Intergenic
1185524627 X:767478-767500 CGTTGGAAGAAGCGGGGAGGGGG + Intergenic
1185537306 X:872790-872812 GAGGGGAAGGGGAGGGGAGAGGG - Intergenic
1185537315 X:872808-872830 GAGGGGAAGGGGAGGGGAGAGGG - Intergenic
1185581369 X:1213240-1213262 GAGGGGAGGGGGAGGGGAGGTGG - Intergenic
1185608485 X:1380550-1380572 GAGGGGGAGGAGAGGCGAGGGGG + Intronic
1185630846 X:1514854-1514876 CAGGGGAAGGGGAGGGGGAGGGG - Intronic
1185645209 X:1610838-1610860 CAGAGGGAGAGGAGGGGAGGGGG - Intergenic
1185688228 X:1948141-1948163 AAGTGGTAGGAGAGGGTAGAAGG + Intergenic
1185688325 X:1948435-1948457 GAGGAGAAGGAGAAGGGAGGAGG + Intergenic
1185688517 X:2133680-2133702 AAGTGGTAGGAGAGGGTAGAAGG + Intergenic
1185688603 X:2133957-2133979 GAGGAGAAGGAGAAGGGAGGAGG + Intergenic
1185713019 X:2319232-2319254 GAGAGGAGGGGGAGGGGAGGAGG - Intronic
1186045571 X:5532888-5532910 CAGAGGAAGAAGGAGGGAGGGGG + Intergenic
1186218040 X:7321274-7321296 GAGTGGAGGGAAAGAGGAGGAGG + Intronic
1186250450 X:7660331-7660353 CAGTGGTGGGAGAGGGAGGGTGG + Intergenic
1186302589 X:8216773-8216795 AAGTGGATGCTGAGGGGAGGAGG - Intergenic
1186410605 X:9342293-9342315 CGGGGGAGGGGGAGGGGAGGTGG - Intergenic
1186435969 X:9543467-9543489 AAGAGGGAGGAGGGGGGAGGAGG - Intronic
1186532851 X:10314690-10314712 GAGAGGCAGGAGAGGGAAGGTGG + Intergenic
1186819502 X:13272463-13272485 GTGTGTAAGGAGTGGGGAGGCGG - Intergenic
1186871774 X:13781044-13781066 CAGTGGGAGGAAGTGGGAGGTGG - Intronic
1187028701 X:15463024-15463046 AAGAGGAGGGAGAGAGGAGGGGG - Intronic
1187119675 X:16392165-16392187 CAGTGGAGGGTGAGTGGTGGTGG - Intergenic
1187426827 X:19185355-19185377 GAGAGAAAGGAGAGGGGAGGAGG - Intergenic
1187531454 X:20100599-20100621 CAGTGGAAGTAGAGCTGGGGGGG + Intronic
1187576197 X:20559084-20559106 AAGGGGAAGGAGAAGGGAAGGGG - Intergenic
1187576203 X:20559101-20559123 AAGGGGAAGGAGAAGGGAAGGGG - Intergenic
1187665265 X:21601567-21601589 CATAGGAAAGAGATGGGAGGAGG - Intronic
1187704273 X:21993902-21993924 CAGGAGGAGGAGAGGGAAGGAGG - Intronic
1187975956 X:24705691-24705713 CAGGGGCAGGGGAGGGGGGGAGG - Intronic
1188085287 X:25895507-25895529 CAGGGAAAGGAAAGGGGAGAAGG + Intergenic
1189262633 X:39689186-39689208 TAGGGGAGGGAGAGGGGAGGAGG - Intergenic
1189317149 X:40064258-40064280 CAGTGGATGGACAGGAGATGTGG - Intronic
1189434168 X:40976536-40976558 CAGAGGAAAGGGTGGGGAGGGGG - Intergenic
1189667744 X:43375571-43375593 CCGTGGAAGGTGGGGGAAGGAGG - Intergenic
1189838245 X:45042250-45042272 CCGTGGAGGGAGAGGGGAGAGGG + Intronic
1190115208 X:47621865-47621887 CTGTGGAAGCCTAGGGGAGGAGG - Intergenic
1190214766 X:48472671-48472693 GAATGGATGCAGAGGGGAGGGGG - Intergenic
1190339049 X:49282023-49282045 CCATGGACGGAGAGGGGTGGGGG - Exonic
1190437040 X:50435814-50435836 CAGTGGTAGGTGAGAGCAGGAGG + Intronic
1190915266 X:54807660-54807682 CCGAGGAAGGCGAGGGGGGGTGG + Exonic
1191739273 X:64419250-64419272 GAGTGGAAGGTGAGAGGAGGGGG - Intergenic
1191861437 X:65668712-65668734 CCCAGGAGGGAGAGGGGAGGAGG + Intronic
1192182403 X:68924421-68924443 AAGTAGGAGGAGAGGGAAGGAGG - Intergenic
1192244557 X:69361788-69361810 CAGGGGTGGGAGATGGGAGGAGG + Intergenic
1192562030 X:72133535-72133557 AAGGTGAAGGAGAGGGAAGGAGG - Intergenic
1192657304 X:73004424-73004446 GAAGGGAAGGAGAGGAGAGGTGG - Exonic
1192664816 X:73078583-73078605 GAAGGGAAGGAGAGGAGAGGTGG + Exonic
1193321196 X:80123434-80123456 CAGGAGAAGGTGAGGGGCGGAGG - Intergenic
1193719946 X:84974887-84974909 GTGTGGAGGGAGAGGCGAGGCGG + Intergenic
1193847790 X:86496560-86496582 CAATGTAAAGAGAAGGGAGGGGG + Intronic
1194367580 X:93028513-93028535 CAGTGAAGGGAGATGGGAGTGGG - Intergenic
1194992930 X:100564111-100564133 CAGTGGAGGAAGAGGGAAGAGGG + Intergenic
1195109349 X:101629991-101630013 GAGAGGAGGGAGAGGGGAGAAGG + Intergenic
1195314031 X:103660335-103660357 CAATGGATGGAGAGGTGAGATGG - Intergenic
1195519409 X:105813614-105813636 CAGTGGGGTGAGATGGGAGGAGG + Intergenic
1195520361 X:105822476-105822498 CGGTGCAAGGAGAGGGGACCCGG - Intergenic
1195703816 X:107724225-107724247 CAGTGGCAGGAGGAGGCAGGGGG + Intronic
1195825188 X:108991995-108992017 GAGTGGAGGGTTAGGGGAGGGGG - Intergenic
1196237448 X:113299785-113299807 CAGGGGATGGGGAGGGGAGAGGG - Intergenic
1196239874 X:113330915-113330937 CAGAGGGTGGAGAGGGGAGGAGG - Intergenic
1196329473 X:114453609-114453631 CAGTGGAAGGACAGAGGATATGG + Intergenic
1196534422 X:116825164-116825186 CAATGGAAGAGGAGGGGAGGGGG + Intergenic
1196599226 X:117583034-117583056 GAGCAGAAGGAGAGGGGAGGAGG - Intergenic
1196754076 X:119142796-119142818 AAGAGGAAAGAGAGGGGAGGAGG + Intronic
1196893505 X:120311463-120311485 GAGTGGAAGGGAGGGGGAGGCGG - Intronic
1197157033 X:123282301-123282323 CAGTGAAGGGAAAGAGGAGGGGG - Intronic
1197169698 X:123418199-123418221 CATTGAAAGGAGAAGGTAGGAGG - Intronic
1197169949 X:123421708-123421730 CAGTGGGAGCTGAGGGAAGGTGG - Intronic
1197753932 X:129982341-129982363 CACTGGGAGGGGAGGAGAGGAGG - Intronic
1197884087 X:131200114-131200136 TTGTGAAAGGAGAGGGGAGAAGG + Intergenic
1197906080 X:131427276-131427298 CAGGAGGAGGAGAGAGGAGGAGG - Intergenic
1198024002 X:132687248-132687270 CAGCAGAAGGGGAAGGGAGGAGG + Intronic
1198064500 X:133083110-133083132 AAGTTCAAGGGGAGGGGAGGAGG + Intronic
1198416883 X:136429380-136429402 CAGGGGCAGGAGCAGGGAGGTGG - Intergenic
1198520667 X:137449246-137449268 CAGTGAAAGGAAAAGGGAGAAGG - Intergenic
1198562697 X:137867944-137867966 CAGGGAAAGGAGAGGGGCAGAGG + Intergenic
1198810785 X:140534185-140534207 AAGAGGAAGGAGGGAGGAGGAGG + Intergenic
1199728394 X:150606950-150606972 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
1200075044 X:153546662-153546684 GGGTGGGAGGAGCGGGGAGGAGG + Intronic
1200141199 X:153903919-153903941 CAGGGGAAGGAGAGAGGTGTTGG + Intronic
1200179317 X:154140814-154140836 CCCAGGAAGGAGAGTGGAGGTGG - Intergenic
1200316808 X:155142014-155142036 GAGTGGAGGGAGAGGGGAGGAGG + Intronic
1200334863 X:155339831-155339853 CAGAGGCAGGGGAGGCGAGGAGG - Intergenic
1200351603 X:155501390-155501412 CAGAGGCAGGGGAGGCGAGGAGG + Intronic
1200675784 Y:6144772-6144794 CAGTGAAGGGAGATGGGAGTGGG - Intergenic
1200734829 Y:6782919-6782941 CACTGGGAGGAGAGCAGAGGAGG + Intergenic
1201021685 Y:9664908-9664930 GAGTGGGGGGAGGGGGGAGGGGG + Intergenic
1201156876 Y:11138524-11138546 CATAGGAGTGAGAGGGGAGGAGG - Intergenic
1201245027 Y:11995069-11995091 CTGAGGAAGCAGAGAGGAGGAGG + Intergenic
1201355980 Y:13097421-13097443 CAGTGGAAGGAGATAGGGGTGGG - Intergenic
1201452939 Y:14136067-14136089 GGATGGAAGGGGAGGGGAGGGGG - Intergenic
1202136493 Y:21670914-21670936 GAAGGGAAGGGGAGGGGAGGGGG - Intergenic
1202627119 Y:56871089-56871111 CCGTGGAAGGGGAGGAGGGGTGG - Intergenic