ID: 1130577864

View in Genome Browser
Species Human (GRCh38)
Location 15:85108237-85108259
Sequence TCGGATCCTGTACATGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 50}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130577858_1130577864 16 Left 1130577858 15:85108198-85108220 CCTTTTCGATGGTGCAAAGGAAG 0: 1
1: 0
2: 1
3: 7
4: 92
Right 1130577864 15:85108237-85108259 TCGGATCCTGTACATGAGCAGGG 0: 1
1: 0
2: 0
3: 1
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130577864 Original CRISPR TCGGATCCTGTACATGAGCA GGG Intronic
905864529 1:41369499-41369521 TCAGATCCTCTATATCAGCATGG + Intronic
914675841 1:149906666-149906688 GCCGATCTTGTCCATGAGCAGGG + Exonic
915273488 1:154772318-154772340 GCGCATCCTGTACATCAGCCTGG - Exonic
915853415 1:159352778-159352800 TCTGATCCTGTTCATGAGGAAGG - Intergenic
917985116 1:180308663-180308685 TGAGATCCTGCACATGAGCCAGG - Intronic
1068069632 10:52180750-52180772 TAGGAGCATGTACATGCGCACGG + Intronic
1070336029 10:75455864-75455886 TCGGAGCCTGTACAACATCAGGG + Intronic
1071489619 10:86127492-86127514 TCGGATCTTTTTCAGGAGCAGGG - Intronic
1072095420 10:92173761-92173783 TTGGATGCTGCACATGAACATGG - Intronic
1074423089 10:113326695-113326717 TCTGATTCTGGACATGAGTAAGG - Intergenic
1084938063 11:72597699-72597721 TTGGACCCTGCACATGTGCAAGG + Intronic
1086280789 11:85185506-85185528 TGAGATACTCTACATGAGCATGG - Intronic
1093591797 12:20910572-20910594 TACGATACTGTACATGAACATGG + Intronic
1095893500 12:47257458-47257480 TCAGATCCTGTGCATGTCCACGG + Intergenic
1105869557 13:24492126-24492148 TCGGATCCTCTGCAGGAGAAAGG - Intronic
1107437229 13:40390639-40390661 AAGGATGCTGTACATCAGCAAGG - Intergenic
1130577864 15:85108237-85108259 TCGGATCCTGTACATGAGCAGGG + Intronic
1140830119 16:78743048-78743070 TCACTTCCTGTTCATGAGCACGG - Intronic
1145796342 17:27657517-27657539 TCGGGTGTGGTACATGAGCACGG + Intergenic
1153486426 18:5603421-5603443 TTGGTTCCTGTAGCTGAGCAAGG - Intronic
1158689889 18:59650788-59650810 ACCGATCCTGTACCTGGGCAAGG + Intronic
1162494409 19:11015294-11015316 TGGGATCCTGGACCAGAGCAAGG - Intronic
1162971595 19:14184043-14184065 TCGCATCCTCACCATGAGCAAGG + Intronic
1165377252 19:35451471-35451493 TCTGAGCCTGGAGATGAGCAGGG + Exonic
1166369843 19:42294594-42294616 TCGGCTTCTGTACCTGTGCAGGG - Exonic
927940779 2:27101605-27101627 TTGGATCCTGTCCAGGAGCCTGG - Exonic
937808367 2:126171601-126171623 GGGGATCCTGTGCATGAGAATGG + Intergenic
1171981408 20:31631872-31631894 TTGGCTCCTGCACATGGGCATGG - Intergenic
1176116471 20:63433802-63433824 GCGGTACCTGTACATGGGCACGG + Exonic
1183872808 22:40753329-40753351 CCAGATCCTGTGCATGCGCAAGG + Intergenic
1184615872 22:45638105-45638127 TATGGTCTTGTACATGAGCAAGG + Intergenic
949446553 3:4141044-4141066 TCTAATGCTGTACATGAGGATGG - Intronic
949593777 3:5522393-5522415 TTGCTTCCTGTCCATGAGCATGG + Intergenic
951459840 3:22939164-22939186 TCCCACCCTGTACAAGAGCAAGG + Intergenic
966624991 3:182006032-182006054 TGGAATTCTTTACATGAGCAAGG - Intergenic
967218176 3:187227699-187227721 TCTGGTCCTGGACATGGGCAGGG - Intronic
973981776 4:56314037-56314059 TAGGATCCACAACATGAGCAAGG + Exonic
976322310 4:83729890-83729912 TGAGATCCTATCCATGAGCATGG - Intergenic
989721040 5:44528358-44528380 TGGGATCCTAGACCTGAGCAAGG - Intergenic
1010444446 6:75934955-75934977 TTGGATCCTGTCCAAGGGCAAGG + Intronic
1016895968 6:149053432-149053454 TATGACCCTGAACATGAGCATGG - Intronic
1020939703 7:14516832-14516854 TCTCTTCCTGTCCATGAGCATGG - Intronic
1021918192 7:25456237-25456259 GCGGTTCCTGTAAATGAGGATGG + Intergenic
1023480796 7:40631829-40631851 TAGGAGCCTGTTCATGACCACGG - Intronic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1035468581 7:159095721-159095743 TTGGAGCCTGGACAGGAGCAGGG - Intronic
1049610168 8:143551432-143551454 TTGGATGCAGTACAAGAGCATGG + Intergenic
1058171031 9:101681593-101681615 TTGGATCCTGTAAATGAAAAGGG - Intronic
1062243307 9:135551122-135551144 TCGGTTCCTGCCCATGAGGAGGG + Intergenic
1190289103 X:48980407-48980429 AGGGACCCTGTACTTGAGCAGGG + Intronic
1197940837 X:131787759-131787781 TCAGCTCCTGCACATGAGTAAGG + Intergenic
1198911818 X:141623440-141623462 CCTGATCCTATTCATGAGCAAGG - Intronic