ID: 1130582608

View in Genome Browser
Species Human (GRCh38)
Location 15:85152152-85152174
Sequence CAGTCCTGGAGGTCAGGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130582608_1130582617 12 Left 1130582608 15:85152152-85152174 CCTACCCCTGACCTCCAGGACTG No data
Right 1130582617 15:85152187-85152209 GAGTTTGAGTTAATTACCAGTGG No data
1130582608_1130582615 -10 Left 1130582608 15:85152152-85152174 CCTACCCCTGACCTCCAGGACTG No data
Right 1130582615 15:85152165-85152187 TCCAGGACTGGGAGAAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130582608 Original CRISPR CAGTCCTGGAGGTCAGGGGT AGG (reversed) Intergenic