ID: 1130582612

View in Genome Browser
Species Human (GRCh38)
Location 15:85152157-85152179
Sequence TCTCCCAGTCCTGGAGGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130582612_1130582617 7 Left 1130582612 15:85152157-85152179 CCCTGACCTCCAGGACTGGGAGA No data
Right 1130582617 15:85152187-85152209 GAGTTTGAGTTAATTACCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130582612 Original CRISPR TCTCCCAGTCCTGGAGGTCA GGG (reversed) Intergenic