ID: 1130582613

View in Genome Browser
Species Human (GRCh38)
Location 15:85152158-85152180
Sequence TTCTCCCAGTCCTGGAGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130582613_1130582617 6 Left 1130582613 15:85152158-85152180 CCTGACCTCCAGGACTGGGAGAA No data
Right 1130582617 15:85152187-85152209 GAGTTTGAGTTAATTACCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130582613 Original CRISPR TTCTCCCAGTCCTGGAGGTC AGG (reversed) Intergenic