ID: 1130582614

View in Genome Browser
Species Human (GRCh38)
Location 15:85152163-85152185
Sequence AGCTCTTCTCCCAGTCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130582614_1130582620 28 Left 1130582614 15:85152163-85152185 CCTCCAGGACTGGGAGAAGAGCT No data
Right 1130582620 15:85152214-85152236 TTATTTAATCAATCACGCCTAGG No data
1130582614_1130582617 1 Left 1130582614 15:85152163-85152185 CCTCCAGGACTGGGAGAAGAGCT No data
Right 1130582617 15:85152187-85152209 GAGTTTGAGTTAATTACCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130582614 Original CRISPR AGCTCTTCTCCCAGTCCTGG AGG (reversed) Intergenic